Incidental Mutation 'R5180:Atpaf2'
ID399752
Institutional Source Beutler Lab
Gene Symbol Atpaf2
Ensembl Gene ENSMUSG00000042709
Gene NameATP synthase mitochondrial F1 complex assembly factor 2
SynonymsATP12p, ATP12
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60400626-60418457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60405869 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 153 (L153S)
Ref Sequence ENSEMBL: ENSMUSP00000135761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108721] [ENSMUST00000145532]
Predicted Effect probably benign
Transcript: ENSMUST00000108721
SMART Domains Protein: ENSMUSP00000104361
Gene: ENSMUSG00000042709

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Pfam:ATP12 56 177 7.9e-43 PFAM
low complexity region 227 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141987
Predicted Effect possibly damaging
Transcript: ENSMUST00000145532
AA Change: L153S

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135761
Gene: ENSMUSG00000042709
AA Change: L153S

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Pfam:ATP12 56 154 9.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156966
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor for the F(1) component of the mitochondrial ATP synthase. This protein binds specifically to the F1 alpha subunit and is thought to prevent this subunit from forming nonproductive homooligomers during enzyme assembly. This gene is located within the Smith-Magenis syndrome region on chromosome 17. An alternatively spliced transcript variant has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Atpaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Atpaf2 APN 11 60409584 critical splice donor site probably null
IGL00504:Atpaf2 APN 11 60405803 missense probably damaging 1.00
IGL01941:Atpaf2 APN 11 60403898 missense probably benign 0.01
IGL02960:Atpaf2 APN 11 60405824 missense probably damaging 0.99
IGL03082:Atpaf2 APN 11 60403844 missense probably damaging 0.99
R1103:Atpaf2 UTSW 11 60403950 missense probably benign 0.06
R4782:Atpaf2 UTSW 11 60404412 missense probably damaging 0.99
R5569:Atpaf2 UTSW 11 60416880 missense probably damaging 0.98
R5947:Atpaf2 UTSW 11 60405882 splice site probably benign
R6388:Atpaf2 UTSW 11 60417007 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGAGATTGCAGCTGTAC -3'
(R):5'- TCCAGGTAGTGAGCTTCTGAAGG -3'

Sequencing Primer
(F):5'- CTGTACTGTGTGGCCCTGAC -3'
(R):5'- CTTCTGAAGGGAGGCTAGAGCTG -3'
Posted On2016-07-06