Incidental Mutation 'R5180:Akap10'
ID399756
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61916189 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 72 (A72T)
Ref Sequence ENSEMBL: ENSMUSP00000104350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058173] [ENSMUST00000102650] [ENSMUST00000108710]
Predicted Effect probably benign
Transcript: ENSMUST00000058173
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102650
AA Change: A72T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: A72T

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108710
AA Change: A72T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804
AA Change: A72T

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACACAGTTCAGTATCCTATGG -3'
(R):5'- GCCTGCCCATAAGTTTTAAGTAATC -3'

Sequencing Primer
(F):5'- TGGTAGAATCTCACACTGATCAGG -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2016-07-06