Incidental Mutation 'R5193:Abhd12'
ID399816
Institutional Source Beutler Lab
Gene Symbol Abhd12
Ensembl Gene ENSMUSG00000032046
Gene Nameabhydrolase domain containing 12
Synonyms
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150832493-150904741 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 150835306 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 56 (*56R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441] [ENSMUST00000056149] [ENSMUST00000141899]
Predicted Effect probably benign
Transcript: ENSMUST00000045441
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056149
AA Change: D332E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046
AA Change: D332E

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138608
Predicted Effect probably benign
Transcript: ENSMUST00000141899
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145826
AA Change: *56R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156641
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurological symptoms of neurodegeneration, hearing loss, ataxia, microgliosis and reduced brain lysophosphatidylserine lipase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Abhd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Abhd12 APN 2 150848421 missense probably benign 0.00
IGL02399:Abhd12 APN 2 150858493 splice site probably benign
IGL02437:Abhd12 APN 2 150834369 missense probably benign 0.01
IGL02981:Abhd12 APN 2 150833124 missense probably benign
R0423:Abhd12 UTSW 2 150838392 missense possibly damaging 0.89
R0617:Abhd12 UTSW 2 150846365 critical splice acceptor site probably null
R0745:Abhd12 UTSW 2 150833148 splice site probably null
R1651:Abhd12 UTSW 2 150848421 missense probably benign 0.00
R1829:Abhd12 UTSW 2 150843398 missense probably damaging 1.00
R1832:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R1833:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R2298:Abhd12 UTSW 2 150901494 intron probably benign
R3153:Abhd12 UTSW 2 150834355 missense probably benign 0.21
R4077:Abhd12 UTSW 2 150848459 critical splice acceptor site probably null
R4508:Abhd12 UTSW 2 150904355 critical splice donor site probably benign
R5898:Abhd12 UTSW 2 150839778 missense possibly damaging 0.89
R6250:Abhd12 UTSW 2 150839747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCTTGACCCTGACAGTAG -3'
(R):5'- AAAAGAAACGTAGCTACATTCAGGC -3'

Sequencing Primer
(F):5'- TCATAGGTCGTCAAGCACCTG -3'
(R):5'- CGTAGCTACATTCAGGCTATTAAG -3'
Posted On2016-07-06