Incidental Mutation 'R5193:Cd151'
ID399841
Institutional Source Beutler Lab
Gene Symbol Cd151
Ensembl Gene ENSMUSG00000025510
Gene NameCD151 antigen
SynonymsTspan24, PETA-3, SFA-1
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141467392-141471473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141470693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 253 (Y253C)
Ref Sequence ENSEMBL: ENSMUSP00000136331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026585] [ENSMUST00000043870] [ENSMUST00000053670] [ENSMUST00000058746] [ENSMUST00000106000] [ENSMUST00000138092] [ENSMUST00000146305] [ENSMUST00000170879] [ENSMUST00000177840] [ENSMUST00000209892] [ENSMUST00000209988] [ENSMUST00000211071]
Predicted Effect probably benign
Transcript: ENSMUST00000026585
SMART Domains Protein: ENSMUSP00000026585
Gene: ENSMUSG00000025511

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 230 4.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043870
SMART Domains Protein: ENSMUSP00000043204
Gene: ENSMUSG00000038489

DomainStartEndE-ValueType
Pfam:RNA_pol_N 1 59 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058746
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061636
Gene: ENSMUSG00000025510
AA Change: Y253C

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect probably damaging
Transcript: ENSMUST00000106000
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510
AA Change: Y253C

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect probably benign
Transcript: ENSMUST00000138092
SMART Domains Protein: ENSMUSP00000115421
Gene: ENSMUSG00000025511

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 154 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146305
SMART Domains Protein: ENSMUSP00000118533
Gene: ENSMUSG00000025511

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 158 2.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170879
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171994
Predicted Effect probably damaging
Transcript: ENSMUST00000177840
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510
AA Change: Y253C

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209698
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210308
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211522
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene display increased bleeding time, impaired keratinocyte migration, hyperproliferation of stimulated T cells, impaired pathologic angiogenesis in several in vivo assays, and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Cd151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Cd151 APN 7 141470362 missense probably benign 0.43
IGL02023:Cd151 APN 7 141470457 missense probably damaging 1.00
R0395:Cd151 UTSW 7 141470391 missense probably damaging 1.00
R0526:Cd151 UTSW 7 141470591 missense probably damaging 0.99
R1173:Cd151 UTSW 7 141470656 missense probably damaging 1.00
R1436:Cd151 UTSW 7 141469284 missense probably damaging 0.96
R1510:Cd151 UTSW 7 141470367 missense probably benign 0.01
R2847:Cd151 UTSW 7 141469550 missense probably damaging 1.00
R7362:Cd151 UTSW 7 141469589 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGTGGGTTCTCAGCAAGG -3'
(R):5'- TACGCTGCTTCGAGCTTTG -3'

Sequencing Primer
(F):5'- CTGGTCTTCAGGCAGCC -3'
(R):5'- ACTTGAAGGTGCATGCCC -3'
Posted On2016-07-06