Incidental Mutation 'R5193:Scn10a'
ID399852
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119609655 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1716 (N1716S)
Ref Sequence ENSEMBL: ENSMUSP00000150830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably damaging
Transcript: ENSMUST00000084787
AA Change: N1716S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: N1716S

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213392
AA Change: N1715S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214408
AA Change: N1716S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGAGTGTGTCTGCAAAGTC -3'
(R):5'- TCGACGACATGTTCAACTTCAAG -3'

Sequencing Primer
(F):5'- TGTCTGCAAAGTCTGAGAGGGC -3'
(R):5'- GTTCAACTTCAAGACCTTTGGCAAC -3'
Posted On2016-07-06