Incidental Mutation 'R5193:Kif1bp'
ID399857
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62559396 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000065160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065887
AA Change: D489G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: D489G

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159704
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162263
Predicted Effect probably benign
Transcript: ENSMUST00000162525
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
Predicted Effect probably benign
Transcript: ENSMUST00000162759
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208223
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
IGL02980:Kif1bp UTSW 10 62559168 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 unclassified probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R3848:Kif1bp UTSW 10 62569470 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R4489:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 intron probably null
R6513:Kif1bp UTSW 10 62575034 intron probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R6916:Kif1bp UTSW 10 62566064 missense probably benign 0.05
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGCTACCCGGAATTTAGC -3'
(R):5'- CCACATTGAAGTTGTCCAGGAC -3'

Sequencing Primer
(F):5'- GCTACCCGGAATTTAGCTAACATGG -3'
(R):5'- CATTGAAGTTGTCCAGGACCACAG -3'
Posted On2016-07-06