Incidental Mutation 'R5193:Or1e16'
ID 399862
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 042769-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5193 (G1)
Quality Score 217
Status Not validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TAGCGGTCGTA to T at 73286479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,677,226 (GRCm39) *56R probably null Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Arfgap3 C T 15: 83,216,898 (GRCm39) A156T probably benign Het
Bpifc T C 10: 85,836,497 (GRCm39) T3A probably benign Het
Ccdc7a T A 8: 129,715,278 (GRCm39) I269L probably benign Het
Cd151 A G 7: 141,050,606 (GRCm39) Y253C probably damaging Het
Cenpl C A 1: 160,911,037 (GRCm39) S328* probably null Het
Cfl1 T A 19: 5,542,580 (GRCm39) V20D probably damaging Het
Clec14a A G 12: 58,315,400 (GRCm39) L74P probably damaging Het
Cnn1 A T 9: 22,019,132 (GRCm39) D196V probably damaging Het
Cst13 C A 2: 148,670,143 (GRCm39) C104* probably null Het
Det1 A G 7: 78,493,302 (GRCm39) V234A probably damaging Het
Efnb2 A G 8: 8,673,162 (GRCm39) M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 (GRCm39) K339* probably null Het
Fnta A T 8: 26,501,246 (GRCm39) probably null Het
Fsip2 A T 2: 82,813,338 (GRCm39) Y3219F possibly damaging Het
Gprin2 C T 14: 33,916,832 (GRCm39) V313M possibly damaging Het
Hars1 A G 18: 36,900,358 (GRCm39) L448S possibly damaging Het
Hipk3 A G 2: 104,260,345 (GRCm39) I1166T possibly damaging Het
Il31ra T C 13: 112,660,864 (GRCm39) E602G probably benign Het
Kctd15 A G 7: 34,344,282 (GRCm39) L123P probably damaging Het
Kifbp T C 10: 62,395,175 (GRCm39) D489G possibly damaging Het
Krt1 C A 15: 101,754,357 (GRCm39) S631I unknown Het
Lancl1 T A 1: 67,060,173 (GRCm39) Y84F probably benign Het
Lcor A G 19: 41,570,969 (GRCm39) D54G probably damaging Het
Mafa G T 15: 75,619,666 (GRCm39) P36T unknown Het
Magi2 G A 5: 20,563,970 (GRCm39) probably null Het
Mcm9 T A 10: 53,492,134 (GRCm39) I396F probably damaging Het
Mrgprh T C 17: 13,095,942 (GRCm39) F61L probably damaging Het
Or10g1b A G 14: 52,628,069 (GRCm39) W54R probably benign Het
Or51a7 T A 7: 102,615,143 (GRCm39) F279I possibly damaging Het
Or5w17 A T 2: 87,583,448 (GRCm39) D296E possibly damaging Het
Pcsk5 T A 19: 17,542,174 (GRCm39) T806S possibly damaging Het
Pigc T C 1: 161,798,465 (GRCm39) I149T possibly damaging Het
Pou5f2 C A 13: 78,173,083 (GRCm39) N8K probably benign Het
Pou6f2 T C 13: 18,300,129 (GRCm39) probably benign Het
Prl3d2 T A 13: 27,306,312 (GRCm39) M13K possibly damaging Het
Pzp T C 6: 128,479,297 (GRCm39) N619D probably benign Het
Rnps1 G A 17: 24,637,517 (GRCm39) S53N probably benign Het
Scaf8 C G 17: 3,240,440 (GRCm39) A604G probably benign Het
Scn10a T C 9: 119,438,721 (GRCm39) N1716S probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc34a1 A G 13: 24,003,845 (GRCm39) probably null Het
Syne2 A G 12: 76,141,194 (GRCm39) D6102G probably damaging Het
Tbc1d16 A T 11: 119,049,646 (GRCm39) D283E probably benign Het
Tet1 T C 10: 62,674,026 (GRCm39) D1350G probably benign Het
Trpa1 A G 1: 14,946,141 (GRCm39) Y997H possibly damaging Het
Tyro3 T C 2: 119,640,998 (GRCm39) L494P probably damaging Het
Uba6 G T 5: 86,272,281 (GRCm39) Q803K probably benign Het
Vgll2 T A 10: 51,904,088 (GRCm39) L317Q possibly damaging Het
Wdr62 A T 7: 29,964,592 (GRCm39) I384N probably damaging Het
Wdtc1 G A 4: 133,021,678 (GRCm39) R619* probably null Het
Xkr6 A G 14: 64,056,356 (GRCm39) D89G possibly damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2016-07-06