Incidental Mutation 'R5193:Pou5f2'
ID399882
Institutional Source Beutler Lab
Gene Symbol Pou5f2
Ensembl Gene ENSMUSG00000093668
Gene NamePOU domain class 5, transcription factor 2
SynonymsSprm1, 1700013G10Rik
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location78024902-78026295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78024964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 8 (N8K)
Ref Sequence ENSEMBL: ENSMUSP00000135597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091459] [ENSMUST00000099358] [ENSMUST00000163257] [ENSMUST00000175955] [ENSMUST00000224217]
Predicted Effect probably benign
Transcript: ENSMUST00000091459
SMART Domains Protein: ENSMUSP00000089038
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
Pfam:Arb2 30 178 7.8e-38 PFAM
SCOP:d1imja_ 224 295 2e-3 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099358
SMART Domains Protein: ENSMUSP00000096960
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
SCOP:d1imja_ 160 231 2e-3 SMART
low complexity region 277 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163257
SMART Domains Protein: ENSMUSP00000133140
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Arb2 78 228 3.5e-44 PFAM
SCOP:d1imja_ 270 341 2e-3 SMART
low complexity region 387 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175955
AA Change: N8K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135597
Gene: ENSMUSG00000093668
AA Change: N8K

DomainStartEndE-ValueType
POU 107 181 8.68e-33 SMART
HOX 199 261 2.57e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224217
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null male mice exhibit reduced male fertility in spite of normal morphology and sperm count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Pou5f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Pou5f2 APN 13 78025938 intron probably benign
IGL01726:Pou5f2 APN 13 78025181 missense possibly damaging 0.55
IGL02484:Pou5f2 APN 13 78025905 missense probably damaging 1.00
IGL02549:Pou5f2 APN 13 78025590 missense probably damaging 0.99
IGL02850:Pou5f2 APN 13 78025059 missense probably benign 0.00
IGL02852:Pou5f2 APN 13 78025059 missense probably benign 0.00
IGL02951:Pou5f2 APN 13 78025118 missense probably benign
R0631:Pou5f2 UTSW 13 78025754 missense probably benign 0.00
R1502:Pou5f2 UTSW 13 78025251 missense probably benign 0.14
R2014:Pou5f2 UTSW 13 78025853 missense probably benign 0.00
R2055:Pou5f2 UTSW 13 78025821 missense probably benign 0.06
R4082:Pou5f2 UTSW 13 78025905 missense probably damaging 1.00
R5487:Pou5f2 UTSW 13 78024999 missense probably benign 0.09
R6880:Pou5f2 UTSW 13 78025494 missense possibly damaging 0.52
R7108:Pou5f2 UTSW 13 78025265 missense possibly damaging 0.95
R7117:Pou5f2 UTSW 13 78025273 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCGAGGACTGACTAAGTTACC -3'
(R):5'- GTGCTATCCCACCTCGGAATTC -3'

Sequencing Primer
(F):5'- GAGGACTGACTAAGTTACCTCAGTC -3'
(R):5'- TATCCCACCTCGGAATTCATAAGGTG -3'
Posted On2016-07-06