Incidental Mutation 'R5268:Ercc6l2'
ID399977
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63869111 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 676 (L676P)
Ref Sequence ENSEMBL: ENSMUSP00000069488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000159957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067821
AA Change: L676P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: L676P

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109776
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 unclassified probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGCTAAAGTTGTGTGTATGC -3'
(R):5'- GGCTTTGAGGTAAAATTCATTTCCC -3'

Sequencing Primer
(F):5'- CAGGGAGTGCCAGGAAATTCTG -3'
(R):5'- TGAGGTAAAATTCATTTCCCACTTC -3'
Posted On2016-07-06