Incidental Mutation 'R5269:Agrn'
ID400044
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Nameagrin
SynonymsNMF380, Agrin, nmf380
MMRRC Submission 042834-MU
Accession Numbers

Genbank: NM_021604; MGI: 87961

Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156165290-156197488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156168990 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1708 (C1708S)
Ref Sequence ENSEMBL: ENSMUSP00000101199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
Predicted Effect probably benign
Transcript: ENSMUST00000071248
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105574
AA Change: C1708S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: C1708S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105575
AA Change: C1712S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: C1712S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154494
Predicted Effect probably benign
Transcript: ENSMUST00000180572
AA Change: C1815S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: C1815S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181062
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Brca2 A G 5: 150,539,223 I817M possibly damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Flrt2 T C 12: 95,779,938 V350A possibly damaging Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Ska3 T A 14: 57,822,116 E84V possibly damaging Het
Slc25a40 T A 5: 8,447,409 probably null Het
Slf1 A T 13: 77,104,581 S274T probably benign Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156170572 splice site probably benign
IGL00811:Agrn APN 4 156168774 missense possibly damaging 0.70
IGL01066:Agrn APN 4 156177343 missense probably benign 0.00
IGL01412:Agrn APN 4 156171034 splice site probably benign
IGL01414:Agrn APN 4 156195239 splice site probably null
IGL02075:Agrn APN 4 156170210 missense probably benign 0.40
IGL02609:Agrn APN 4 156175223 splice site probably benign
IGL02669:Agrn APN 4 156174561 splice site probably benign
IGL02671:Agrn APN 4 156174561 splice site probably benign
IGL02672:Agrn APN 4 156174561 splice site probably benign
IGL02674:Agrn APN 4 156174561 splice site probably benign
IGL02724:Agrn APN 4 156172807 nonsense probably null
IGL02804:Agrn APN 4 156174055 missense probably benign 0.00
IGL02986:Agrn APN 4 156178854 missense possibly damaging 0.84
IGL03160:Agrn APN 4 156170363 missense probably damaging 0.98
F6893:Agrn UTSW 4 156174179 missense probably benign
R0092:Agrn UTSW 4 156178953 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0482:Agrn UTSW 4 156173555 missense probably damaging 0.98
R0531:Agrn UTSW 4 156179434 missense probably benign 0.38
R0536:Agrn UTSW 4 156179553 missense probably benign 0.01
R0690:Agrn UTSW 4 156174453 missense probably damaging 1.00
R0750:Agrn UTSW 4 156166937 nonsense probably null
R1079:Agrn UTSW 4 156177225 missense probably damaging 1.00
R1199:Agrn UTSW 4 156172299 missense probably benign 0.00
R1222:Agrn UTSW 4 156177385 missense probably damaging 0.99
R1534:Agrn UTSW 4 156176684 missense probably damaging 1.00
R1587:Agrn UTSW 4 156179440 missense probably damaging 0.99
R1625:Agrn UTSW 4 156172860 missense probably damaging 1.00
R1698:Agrn UTSW 4 156166558 missense probably benign 0.03
R1717:Agrn UTSW 4 156166519 frame shift probably null
R1718:Agrn UTSW 4 156166519 frame shift probably null
R1721:Agrn UTSW 4 156175173 nonsense probably null
R1765:Agrn UTSW 4 156176827 nonsense probably null
R1840:Agrn UTSW 4 156167415 missense probably damaging 1.00
R1865:Agrn UTSW 4 156166519 frame shift probably null
R2105:Agrn UTSW 4 156177299 nonsense probably null
R2265:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2266:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2269:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2382:Agrn UTSW 4 156176516 missense probably damaging 0.97
R2497:Agrn UTSW 4 156173811 missense probably benign 0.28
R2509:Agrn UTSW 4 156166424 utr 3 prime probably null
R2510:Agrn UTSW 4 156166424 utr 3 prime probably null
R2511:Agrn UTSW 4 156166424 utr 3 prime probably null
R2994:Agrn UTSW 4 156167328 missense possibly damaging 0.79
R3824:Agrn UTSW 4 156169302 missense probably damaging 1.00
R4736:Agrn UTSW 4 156172401 missense probably benign 0.38
R4755:Agrn UTSW 4 156173522 intron probably benign
R4853:Agrn UTSW 4 156185550 critical splice donor site probably null
R4878:Agrn UTSW 4 156170845 missense probably damaging 1.00
R5117:Agrn UTSW 4 156185553 missense probably benign 0.30
R5228:Agrn UTSW 4 156166946 missense probably damaging 1.00
R5236:Agrn UTSW 4 156178858 missense possibly damaging 0.93
R5282:Agrn UTSW 4 156173035 missense probably damaging 1.00
R5449:Agrn UTSW 4 156167280 critical splice donor site probably null
R5560:Agrn UTSW 4 156178497 missense probably damaging 0.99
R5668:Agrn UTSW 4 156167313 missense probably damaging 0.97
R5725:Agrn UTSW 4 156173875 missense probably benign 0.25
R5967:Agrn UTSW 4 156175103 missense probably damaging 1.00
R6226:Agrn UTSW 4 156173609 missense probably damaging 0.96
R6338:Agrn UTSW 4 156170585 missense probably benign 0.17
R6351:Agrn UTSW 4 156179434 missense probably benign 0.00
R6437:Agrn UTSW 4 156176778 missense probably damaging 0.96
R6490:Agrn UTSW 4 156167362 nonsense probably null
R6909:Agrn UTSW 4 156177007 missense possibly damaging 0.90
R7110:Agrn UTSW 4 156178875 missense possibly damaging 0.88
R7123:Agrn UTSW 4 156172840 missense probably benign
R7163:Agrn UTSW 4 156178509 missense probably damaging 1.00
R7180:Agrn UTSW 4 156171839 missense probably benign 0.00
R7251:Agrn UTSW 4 156174606 missense probably damaging 1.00
R7289:Agrn UTSW 4 156178932 missense probably damaging 1.00
R7335:Agrn UTSW 4 156176532 missense probably damaging 1.00
R7336:Agrn UTSW 4 156174914 nonsense probably null
R7406:Agrn UTSW 4 156172301 missense possibly damaging 0.93
R7460:Agrn UTSW 4 156174424 missense probably damaging 0.98
R7531:Agrn UTSW 4 156169804 missense not run
Predicted Primers PCR Primer
(F):5'- GATGTAGGTCCGCCCATCAAAG -3'
(R):5'- ATTGTATGAGGGGCTTAAGTCC -3'

Sequencing Primer
(F):5'- CCATCAAAGGCCAGTGTTTCTAGG -3'
(R):5'- GCTTAAGTCCCCGGTGAG -3'
Posted On2016-07-06