Incidental Mutation 'R5269:R3hdm4'
ID400087
Institutional Source Beutler Lab
Gene Symbol R3hdm4
Ensembl Gene ENSMUSG00000035781
Gene NameR3H domain containing 4
Synonyms
MMRRC Submission 042834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79910052-79921208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79912458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 162 (E162K)
Ref Sequence ENSEMBL: ENSMUSP00000132266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000181321] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000218970] [ENSMUST00000219867]
Predicted Effect probably benign
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045628
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171416
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agrn A T 4: 156,168,990 C1708S probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Brca2 A G 5: 150,539,223 I817M possibly damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Flrt2 T C 12: 95,779,938 V350A possibly damaging Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Ska3 T A 14: 57,822,116 E84V possibly damaging Het
Slc25a40 T A 5: 8,447,409 probably null Het
Slf1 A T 13: 77,104,581 S274T probably benign Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in R3hdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:R3hdm4 APN 10 79912091 missense probably damaging 1.00
PIT4472001:R3hdm4 UTSW 10 79913555 critical splice donor site probably null
R0801:R3hdm4 UTSW 10 79913357 unclassified probably benign
R1167:R3hdm4 UTSW 10 79912073 critical splice donor site probably null
R3622:R3hdm4 UTSW 10 79912681 missense possibly damaging 0.96
R5264:R3hdm4 UTSW 10 79913341 missense probably benign 0.19
R5268:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5357:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5358:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5360:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5362:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5363:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5434:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5435:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5442:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5534:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5921:R3hdm4 UTSW 10 79913619 missense probably damaging 1.00
R6041:R3hdm4 UTSW 10 79913661 missense possibly damaging 0.46
R7391:R3hdm4 UTSW 10 79911109 missense probably benign 0.00
X0022:R3hdm4 UTSW 10 79913652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCATTTCCACTGCCCAG -3'
(R):5'- TCCGTTACTTGGAGGATGAGAG -3'

Sequencing Primer
(F):5'- AGTCCTCTCCTTCCTAACCACTG -3'
(R):5'- TTACTTGGAGGATGAGAGCCAGG -3'
Posted On2016-07-06