Incidental Mutation 'R5269:Flrt2'
ID400101
Institutional Source Beutler Lab
Gene Symbol Flrt2
Ensembl Gene ENSMUSG00000047414
Gene Namefibronectin leucine rich transmembrane protein 2
Synonyms
MMRRC Submission 042834-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location95692226-95785215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95779938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 350 (V350A)
Ref Sequence ENSEMBL: ENSMUSP00000105744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]
PDB Structure
mouse FLRT2 LRR domain in complex with rat Unc5D Ig1 domain [X-RAY DIFFRACTION]
FLRT2 LRR domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057324
AA Change: V350A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: V350A

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110117
AA Change: V350A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: V350A

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agrn A T 4: 156,168,990 C1708S probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Brca2 A G 5: 150,539,223 I817M possibly damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Ska3 T A 14: 57,822,116 E84V possibly damaging Het
Slc25a40 T A 5: 8,447,409 probably null Het
Slf1 A T 13: 77,104,581 S274T probably benign Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in Flrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Flrt2 APN 12 95780529 missense probably damaging 1.00
IGL01083:Flrt2 APN 12 95780347 missense probably benign 0.05
IGL01410:Flrt2 APN 12 95779192 missense probably damaging 1.00
IGL01601:Flrt2 APN 12 95779595 missense probably damaging 0.99
IGL01800:Flrt2 APN 12 95779688 missense probably damaging 1.00
IGL01940:Flrt2 APN 12 95780238 missense probably damaging 1.00
IGL02224:Flrt2 APN 12 95780028 missense possibly damaging 0.58
IGL02272:Flrt2 APN 12 95779704 missense probably damaging 1.00
IGL02452:Flrt2 APN 12 95779483 missense probably benign 0.01
R0966:Flrt2 UTSW 12 95780301 missense possibly damaging 0.70
R1066:Flrt2 UTSW 12 95779059 missense probably damaging 1.00
R1218:Flrt2 UTSW 12 95778953 missense probably benign 0.00
R1442:Flrt2 UTSW 12 95780205 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1746:Flrt2 UTSW 12 95780792 missense possibly damaging 0.90
R1842:Flrt2 UTSW 12 95779284 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779130 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779131 missense probably damaging 1.00
R1959:Flrt2 UTSW 12 95780300 missense probably benign 0.01
R2310:Flrt2 UTSW 12 95780090 missense probably benign 0.01
R3418:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R3419:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R4412:Flrt2 UTSW 12 95780273 missense probably benign
R4617:Flrt2 UTSW 12 95780229 missense possibly damaging 0.96
R4674:Flrt2 UTSW 12 95780688 nonsense probably null
R5001:Flrt2 UTSW 12 95778951 missense probably benign
R5009:Flrt2 UTSW 12 95779773 missense probably damaging 0.98
R5150:Flrt2 UTSW 12 95779203 missense possibly damaging 0.84
R5179:Flrt2 UTSW 12 95780347 missense probably benign 0.05
R5535:Flrt2 UTSW 12 95780426 missense probably benign 0.08
R6172:Flrt2 UTSW 12 95779531 missense probably damaging 1.00
R6180:Flrt2 UTSW 12 95779238 nonsense probably null
R6867:Flrt2 UTSW 12 95779382 missense probably damaging 1.00
R6986:Flrt2 UTSW 12 95780685 missense probably damaging 1.00
R7379:Flrt2 UTSW 12 95780555 missense possibly damaging 0.68
R7407:Flrt2 UTSW 12 95779300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCCGTAAGCTGGAAAG -3'
(R):5'- TCTCTGCCATCCCAATCAGG -3'

Sequencing Primer
(F):5'- CGAATGTTAACTCAAGGAGTCTTCG -3'
(R):5'- CAATCAGGGATGGTGGGAAGTTTC -3'
Posted On2016-07-06