Incidental Mutation 'R5269:Ska3'
ID400113
Institutional Source Beutler Lab
Gene Symbol Ska3
Ensembl Gene ENSMUSG00000021965
Gene Namespindle and kinetochore associated complex subunit 3
Synonyms
MMRRC Submission 042834-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57806561-57826185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57822116 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 84 (E84V)
Ref Sequence ENSEMBL: ENSMUSP00000022536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022536] [ENSMUST00000022538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022536
AA Change: E84V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: E84V

DomainStartEndE-ValueType
PDB:4AJ5|Z 1 101 3e-46 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000022538
SMART Domains Protein: ENSMUSP00000022538
Gene: ENSMUSG00000021967

DomainStartEndE-ValueType
Pfam:MRP-63 13 101 9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225753
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agrn A T 4: 156,168,990 C1708S probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Brca2 A G 5: 150,539,223 I817M possibly damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Flrt2 T C 12: 95,779,938 V350A possibly damaging Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Slc25a40 T A 5: 8,447,409 probably null Het
Slf1 A T 13: 77,104,581 S274T probably benign Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in Ska3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Ska3 APN 14 57822124 missense possibly damaging 0.95
IGL01969:Ska3 APN 14 57811662 missense probably benign 0.00
IGL02539:Ska3 APN 14 57820511 missense possibly damaging 0.86
IGL02665:Ska3 APN 14 57822072 missense probably damaging 1.00
R1276:Ska3 UTSW 14 57820269 missense probably damaging 1.00
R3737:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3738:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3771:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3772:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3773:Ska3 UTSW 14 57810077 missense probably benign 0.06
R6088:Ska3 UTSW 14 57816694 missense probably benign 0.01
R6320:Ska3 UTSW 14 57816691 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGCAGTGTGCTGAACTAG -3'
(R):5'- AGGGGCTTACATACTAGAAAGC -3'

Sequencing Primer
(F):5'- GAGGGGATCAATCAACCA -3'
(R):5'- GCTTTTTGGTCTCTCAAGCATAG -3'
Posted On2016-07-06