Incidental Mutation 'R5195:Olfr744'
ID400161
Institutional Source Beutler Lab
Gene Symbol Olfr744
Ensembl Gene ENSMUSG00000053815
Gene Nameolfactory receptor 744
SynonymsMOR106-13P, GA_x6K02T2PMLR-6326342-6327313
MMRRC Submission 042771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5195 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50614879-50619839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50618786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 188 (L188P)
Ref Sequence ENSEMBL: ENSMUSP00000148954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066457] [ENSMUST00000213668] [ENSMUST00000216690]
Predicted Effect probably damaging
Transcript: ENSMUST00000066457
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066496
Gene: ENSMUSG00000053815
AA Change: L188P

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.9e-48 PFAM
Pfam:7tm_1 45 294 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213668
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216690
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,198,968 Y381C probably damaging Het
Apoo-ps T C 13: 107,414,553 noncoding transcript Het
Arhgef40 T A 14: 51,989,812 S438T possibly damaging Het
Barhl2 A G 5: 106,453,439 L358P possibly damaging Het
Bicra G A 7: 15,979,953 P775S possibly damaging Het
Ccdc78 T A 17: 25,789,988 probably null Het
Ccnb1-ps T A 7: 42,106,098 noncoding transcript Het
Cct6a A T 5: 129,794,655 noncoding transcript Het
Cep120 T A 18: 53,721,698 H455L probably damaging Het
Cobl C T 11: 12,253,565 V964I probably benign Het
Cpt1a A T 19: 3,383,800 I761F possibly damaging Het
Crk T A 11: 75,679,463 Y14N probably damaging Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Fam196a A T 7: 134,884,416 F469I probably damaging Het
Fanca A G 8: 123,303,945 probably benign Het
Gbp4 T A 5: 105,119,532 D507V probably benign Het
Gtf2i A T 5: 134,244,832 L740* probably null Het
Hmgn2 C A 4: 133,967,286 A8S probably benign Het
Hook2 A T 8: 84,994,776 N252I probably damaging Het
Igkv19-93 T A 6: 68,736,526 T39S probably damaging Het
Inpp5j A C 11: 3,499,889 probably null Het
Kbtbd3 G C 9: 4,316,905 E19Q possibly damaging Het
Kcns2 G A 15: 34,839,531 A347T possibly damaging Het
Klhl31 A G 9: 77,650,290 E96G possibly damaging Het
Kptn A G 7: 16,123,103 Y172C probably damaging Het
Krt86 T A 15: 101,476,933 M328K probably benign Het
Lama1 A G 17: 67,764,800 D894G probably benign Het
Lars2 T C 9: 123,453,310 V653A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lhcgr A T 17: 88,742,946 V384D probably damaging Het
Malrd1 C T 2: 16,150,810 T2010M unknown Het
Maml2 T A 9: 13,621,114 N541K probably damaging Het
Med24 T C 11: 98,710,281 K585R possibly damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Mylk T A 16: 34,979,215 F1658L probably damaging Het
Obscn C T 11: 59,060,850 V4392I possibly damaging Het
Olfr975 A G 9: 39,950,679 S31P probably benign Het
Pcnx2 A T 8: 125,801,549 F1311I possibly damaging Het
Pcsk1 T C 13: 75,126,855 L521P probably damaging Het
Pde4a A G 9: 21,204,333 T445A possibly damaging Het
Pgam5 A T 5: 110,265,988 L103* probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Polr2a T C 11: 69,744,079 Y618C probably damaging Het
Pramef25 T A 4: 143,950,880 E43V probably damaging Het
Pramel5 T A 4: 144,271,741 M311L probably benign Het
Rbbp8 T C 18: 11,722,151 F478L probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryk T C 9: 102,867,613 V122A probably benign Het
Sik3 G T 9: 46,208,844 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35e4 T A 11: 3,912,872 I106F possibly damaging Het
Slc41a3 T C 6: 90,633,671 S172P probably damaging Het
Snrnp70 T A 7: 45,394,710 K32N probably damaging Het
Spag17 T C 3: 100,101,388 Y1945H probably benign Het
St7 A G 6: 17,743,637 probably benign Het
Stab1 C A 14: 31,140,521 probably benign Het
Taf13 G A 3: 108,581,074 R91Q probably damaging Het
Tmem200a T C 10: 26,078,956 probably benign Het
Tnc A T 4: 63,967,252 L1871Q probably damaging Het
Toe1 T C 4: 116,804,655 H439R probably damaging Het
Trpm1 T C 7: 64,237,693 V893A possibly damaging Het
Ubr3 G A 2: 69,956,034 A831T probably benign Het
Wdr89 C T 12: 75,633,288 R64Q probably benign Het
Zbed5 G T 5: 129,902,178 V323F probably benign Het
Zeb2 T C 2: 45,001,635 R287G probably damaging Het
Other mutations in Olfr744
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Olfr744 APN 14 50618612 missense probably damaging 1.00
IGL02136:Olfr744 APN 14 50618251 missense possibly damaging 0.86
IGL02165:Olfr744 APN 14 50619011 missense probably damaging 1.00
IGL02207:Olfr744 APN 14 50618558 missense probably damaging 1.00
IGL02556:Olfr744 APN 14 50618728 missense probably benign 0.01
IGL02710:Olfr744 APN 14 50618798 missense probably benign 0.02
R0127:Olfr744 UTSW 14 50618332 missense probably benign
R0389:Olfr744 UTSW 14 50618579 missense probably damaging 1.00
R0603:Olfr744 UTSW 14 50618510 missense probably damaging 1.00
R0927:Olfr744 UTSW 14 50618587 missense possibly damaging 0.47
R1477:Olfr744 UTSW 14 50618713 missense probably damaging 0.98
R1705:Olfr744 UTSW 14 50619122 missense probably benign 0.01
R1800:Olfr744 UTSW 14 50618686 missense probably benign 0.01
R1898:Olfr744 UTSW 14 50618774 missense probably damaging 1.00
R2244:Olfr744 UTSW 14 50618657 missense probably damaging 1.00
R4731:Olfr744 UTSW 14 50618569 missense probably benign 0.11
R4732:Olfr744 UTSW 14 50618569 missense probably benign 0.11
R4733:Olfr744 UTSW 14 50618569 missense probably benign 0.11
R4801:Olfr744 UTSW 14 50619022 missense probably benign 0.01
R4802:Olfr744 UTSW 14 50619022 missense probably benign 0.01
R5068:Olfr744 UTSW 14 50618740 missense probably damaging 1.00
R5069:Olfr744 UTSW 14 50618740 missense probably damaging 1.00
R5070:Olfr744 UTSW 14 50618474 missense probably benign 0.11
R5070:Olfr744 UTSW 14 50618740 missense probably damaging 1.00
R6058:Olfr744 UTSW 14 50618701 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGCCTCTACATTACCCTGC -3'
(R):5'- TCCCATACATGACCAGTACTGAG -3'

Sequencing Primer
(F):5'- ACCCTGCTCTCATGACTGGG -3'
(R):5'- TGCCAGATGAGACCCACAGG -3'
Posted On2016-07-06