Incidental Mutation 'R5270:Cyp3a25'
ID400185
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission 042835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5270 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145981502 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 433 (M433K)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably benign
Transcript: ENSMUST00000068317
AA Change: M433K

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: M433K

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153808
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,294,218 V585A possibly damaging Het
Adam6a A T 12: 113,544,127 H40L possibly damaging Het
Adamts20 G A 15: 94,282,519 P1752S probably benign Het
Atpif1 A G 4: 132,533,300 F27L probably damaging Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ciz1 C A 2: 32,374,499 probably null Het
Crb1 T A 1: 139,236,864 Y1174F probably damaging Het
Csf2rb2 A T 15: 78,291,982 probably null Het
D1Ertd622e T C 1: 97,645,995 Q115R probably damaging Het
Dock4 A G 12: 40,733,271 I735V probably benign Het
Dpp6 C T 5: 27,634,534 S349L probably damaging Het
Epg5 T A 18: 77,983,563 N1256K possibly damaging Het
Epha4 A G 1: 77,506,607 V255A probably damaging Het
Gabrb1 A T 5: 72,108,326 D155V probably damaging Het
Gm13103 A G 4: 143,851,898 M243V probably damaging Het
Gpr35 A T 1: 92,982,577 T4S probably benign Het
Hcrt T C 11: 100,761,997 T64A probably damaging Het
Henmt1 G A 3: 108,960,214 R355H probably benign Het
Hrh1 C A 6: 114,481,218 R487S possibly damaging Het
Ints2 T C 11: 86,215,795 S930G probably damaging Het
Irs2 G A 8: 11,006,678 Q585* probably null Het
Kcns1 C A 2: 164,168,329 R170L probably benign Het
Kdm3b T C 18: 34,827,414 S1351P probably damaging Het
Ly9 T C 1: 171,601,162 T297A probably damaging Het
M6pr G A 6: 122,315,089 D127N possibly damaging Het
Nit2 G A 16: 57,157,131 P179S probably damaging Het
Per1 T C 11: 69,103,598 M516T probably benign Het
Pkdrej A T 15: 85,818,327 I1136N probably damaging Het
Prdm9 G T 17: 15,553,363 T257K probably benign Het
Prkdc T C 16: 15,734,955 L2085P probably damaging Het
Rasgrf1 A C 9: 90,026,694 E1240D probably benign Het
Rrh T C 3: 129,813,349 I142V probably benign Het
Saal1 G T 7: 46,701,733 probably benign Het
Sdcbp2 A G 2: 151,584,892 I70V probably benign Het
Skida1 C A 2: 18,047,649 A231S probably benign Het
Smtnl2 T A 11: 72,399,917 T401S probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spag4 G T 2: 156,065,933 probably benign Het
Tbc1d9 A G 8: 83,233,654 M179V probably benign Het
Tm9sf1 G T 14: 55,636,481 T520N probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Vmn1r47 A T 6: 90,022,543 Q219L probably damaging Het
Vmn2r104 A T 17: 20,038,266 C539S probably damaging Het
Wdr17 G T 8: 54,643,186 S1024R probably benign Het
Zc3h4 A G 7: 16,434,515 T850A unknown Het
Zfa-ps A G 10: 52,543,456 noncoding transcript Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Zfp353-ps G T 8: 42,081,535 noncoding transcript Het
Zfp607a A T 7: 27,878,305 K267* probably null Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATTTTACTTTCCACATGTAAAGC -3'
(R):5'- TGGGAAGGACCTGTAGCTC -3'

Sequencing Primer
(F):5'- ACTTTCCACATGTAAAGCTTTTAGAC -3'
(R):5'- TTTAGTCAGGCACTTGCAGCAAG -3'
Posted On2016-07-06