Mutagenetix > Incidental Mutation

Incidental Mutation 'R5196:Cdh20'

400203

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

042772-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110065730 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 668 (M668K)

Ref Sequence

ENSEMBL: ENSMUSP00000129715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000027542
AA Change: M668K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: M668K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	633	778	6e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112701
AA Change: M668K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: M668K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131464

SMART Domains

Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
PDB:1ZVN\|B	49	70	1e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000134301

SMART Domains

Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
CA	24	111	2.26e-9	SMART
transmembrane domain	125	147	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172005
AA Change: M668K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: M668K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Meta Mutation Damage Score

0.7691

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,686,450 (GRCm39)	T281A	possibly damaging	Het
4930503B20Rik	A	G	3: 146,352,018 (GRCm39)		probably benign	Het
6330409D20Rik	T	A	2: 32,630,552 (GRCm39)		probably benign	Het
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Amigo2	A	G	15: 97,143,942 (GRCm39)	F160S	probably damaging	Het
Arcn1	A	T	9: 44,671,324 (GRCm39)	L68M	probably damaging	Het
Arhgef25	A	G	10: 127,020,978 (GRCm39)	S303P	probably damaging	Het
Asph	A	T	4: 9,607,830 (GRCm39)	S163T	probably damaging	Het
Birc6	T	C	17: 74,913,136 (GRCm39)		probably benign	Het
Bltp3a	A	G	17: 28,075,737 (GRCm39)	I5V	probably benign	Het
Ccm2	G	A	11: 6,511,181 (GRCm39)		probably benign	Het
Cdc42bpa	T	C	1: 179,899,978 (GRCm39)	V431A	probably benign	Het
Cfap43	A	T	19: 47,814,364 (GRCm39)	W157R	probably damaging	Het
Chrm5	T	C	2: 112,310,729 (GRCm39)	Y129C	probably damaging	Het
Chrna5	A	G	9: 54,913,803 (GRCm39)	I421V	possibly damaging	Het
Clk1	T	A	1: 58,453,772 (GRCm39)	T301S	probably benign	Het
Col6a3	G	T	1: 90,744,260 (GRCm39)		probably null	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Fbxw19	T	C	9: 109,313,496 (GRCm39)	Y234C	probably benign	Het
Fgd4	T	A	16: 16,302,006 (GRCm39)	N183I	probably benign	Het
Fnip2	T	C	3: 79,479,845 (GRCm39)		probably benign	Het
Gask1a	T	G	9: 121,794,727 (GRCm39)	S294A	probably benign	Het
Gm9847	T	A	12: 14,545,016 (GRCm39)		noncoding transcript	Het
H2-T23	A	G	17: 36,343,499 (GRCm39)		probably null	Het
Hdlbp	T	C	1: 93,347,915 (GRCm39)	E613G	probably damaging	Het
Kat6a	G	A	8: 23,401,729 (GRCm39)	R366H	probably damaging	Het
Kctd4	A	G	14: 76,200,127 (GRCm39)	T33A	probably benign	Het
Klrb1c	T	A	6: 128,757,262 (GRCm39)	S268C	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lrrfip1	A	G	1: 91,042,330 (GRCm39)	E245G	probably damaging	Het
Mast3	A	T	8: 71,240,889 (GRCm39)	I220N	probably damaging	Het
Mfap3	A	G	11: 57,420,639 (GRCm39)	T207A	probably damaging	Het
Mtdh	G	T	15: 34,118,150 (GRCm39)	K75N	probably damaging	Het
Mybpc1	A	G	10: 88,372,213 (GRCm39)	Y806H	probably damaging	Het
Ntng1	T	C	3: 109,842,299 (GRCm39)	D158G	probably damaging	Het
Odr4	T	A	1: 150,258,140 (GRCm39)	D165V	probably damaging	Het
Or5d46	A	G	2: 88,170,092 (GRCm39)	Y61C	possibly damaging	Het
Or6c216	T	A	10: 129,678,650 (GRCm39)	D87V	possibly damaging	Het
Pask	A	G	1: 93,237,805 (GRCm39)		probably benign	Het
Pif1	G	T	9: 65,495,374 (GRCm39)	A95S	probably benign	Het
Plppr2	T	C	9: 21,852,428 (GRCm39)	F104S	probably damaging	Het
Prmt9	G	A	8: 78,291,626 (GRCm39)	V333M	probably benign	Het
Pten	A	T	19: 32,792,897 (GRCm39)	M239L	probably benign	Het
Rb1cc1	A	G	1: 6,304,454 (GRCm39)	D67G	probably damaging	Het
Reg2	T	A	6: 78,382,530 (GRCm39)	L12*	probably null	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Slc5a7	C	A	17: 54,588,750 (GRCm39)		probably null	Het
Tcaf3	G	T	6: 42,570,649 (GRCm39)	R368S	probably benign	Het
Tfcp2	A	G	15: 100,418,595 (GRCm39)	V189A	probably damaging	Het
Wdr12	T	C	1: 60,126,243 (GRCm39)	S191G	probably damaging	Het
Zfp536	G	A	7: 37,180,185 (GRCm39)	R807W	probably damaging	Het
Zfp647	G	A	15: 76,796,285 (GRCm39)	P125L	probably damaging	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCGTGAAACAGGGAAGC -3'
(R):5'- GAGAGTCATATGGTGGAGCC -3'

Sequencing Primer
(F):5'- CAGGGAAGCCAAACTTTTTGC -3'
(R):5'- ATATGGTGGAGCCCCTGGATC -3'

Posted On

2016-07-06