Incidental Mutation 'R5196:Zfp647'
ID400278
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Namezinc finger protein 647
Synonyms
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76910371-76925448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76912085 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 125 (P125L)
Ref Sequence ENSEMBL: ENSMUSP00000155272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865]
Predicted Effect probably benign
Transcript: ENSMUST00000048854
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: P125L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229055
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably damaging
Transcript: ENSMUST00000229865
AA Change: P125L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3077:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3701:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 unclassified probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5947:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6007:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6305:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCGACCAAAGCACTTTC -3'
(R):5'- AGCAAAGCCAGCATTAAGATTG -3'

Sequencing Primer
(F):5'- TTCCACACTCAATGCAGATATAGGG -3'
(R):5'- TTAAAGCAGCCCTTGTAGGTAGCC -3'
Posted On2016-07-06