Incidental Mutation 'R5197:Hist1h3d'
ID400386
Institutional Source Beutler Lab
Gene Symbol Hist1h3d
Ensembl Gene ENSMUSG00000099583
Gene Namehistone cluster 1, H3d
SynonymsH3-b
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5197 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23575763-23577011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23576130 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 110 (L110Q)
Ref Sequence ENSEMBL: ENSMUSP00000100737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]
PDB Structure
Crystal structure of RAG2-PHD finger in complex with H3R2me2aK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me2 peptide [X-RAY DIFFRACTION]
Histone demethylase KDM2A-H3K36ME1-alpha-KG complex structure [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me2 with alpha-kg [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me3 complex with alpha-kg [X-RAY DIFFRACTION]
crystal structure of histone demethylase KDM2A-H3K36ME3 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME2 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME1 with NOG [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079251
SMART Domains Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090776
SMART Domains Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102969
SMART Domains Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105105
AA Change: L110Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583
AA Change: L110Q

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105106
SMART Domains Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200671
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Srrm2 T C 17: 23,817,384 S1097P probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Hist1h3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5210:Hist1h3d UTSW 13 23575841 missense possibly damaging 0.55
R5211:Hist1h3d UTSW 13 23575841 missense possibly damaging 0.55
R5552:Hist1h3d UTSW 13 23576121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAAGCCTCACCGCTAC -3'
(R):5'- GTACAGGCGTTAAAGGATATTACAG -3'

Sequencing Primer
(F):5'- TCACCGCTACCGTCCCG -3'
(R):5'- CAAGTAATGGAGTTGCTGAGTG -3'
Posted On2016-07-06