Incidental Mutation 'R5197:Srrm2'
ID400404
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission 042773-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5197 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23817384 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1097 (S1097P)
Ref Sequence ENSEMBL: ENSMUSP00000139842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect probably benign
Transcript: ENSMUST00000088621
AA Change: S1001P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: S1001P

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186045
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189977
Predicted Effect probably benign
Transcript: ENSMUST00000190686
AA Change: S1097P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: S1097P

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 T C 9: 54,622,582 E247G possibly damaging Het
Adgra3 A G 5: 49,960,754 F1151L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh4a1 A C 4: 139,648,301 probably benign Het
Anln A T 9: 22,352,781 probably null Het
Aste1 T C 9: 105,405,054 S74P probably damaging Het
Atp6v0e2 G A 6: 48,540,117 R77H probably benign Het
Brpf1 A G 6: 113,319,941 D962G possibly damaging Het
Btbd2 T C 10: 80,646,419 D249G probably damaging Het
Catsper3 T C 13: 55,808,176 probably null Het
Cfap43 A G 19: 47,897,372 L268P probably damaging Het
Cftr T C 6: 18,255,414 V540A probably benign Het
Col22a1 C T 15: 72,009,406 G32D probably damaging Het
Col5a2 G T 1: 45,393,081 P804Q probably benign Het
Cyp2d41-ps A G 15: 82,778,780 noncoding transcript Het
Cyp39a1 T G 17: 43,746,538 L423V possibly damaging Het
Elmo1 T G 13: 20,564,437 V484G probably benign Het
Eps8 C A 6: 137,490,290 Q656H probably damaging Het
Eps8 T C 6: 137,490,291 Q656R possibly damaging Het
Fam71f2 G T 6: 29,281,222 probably benign Het
Fshb T C 2: 107,057,509 D55G possibly damaging Het
Gm13089 A C 4: 143,698,062 C270W possibly damaging Het
Herc1 C A 9: 66,448,504 Q2346K probably damaging Het
Hist1h3d T A 13: 23,576,130 L110Q probably damaging Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Ift74 T A 4: 94,662,596 D328E probably benign Het
Kif21b A T 1: 136,144,625 K23M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lipc T A 9: 70,798,391 E470V probably benign Het
Lrrc4 G T 6: 28,830,143 T68K probably damaging Het
Lrrc63 T A 14: 75,084,882 H594L possibly damaging Het
Mfsd14a A T 3: 116,648,501 probably benign Het
Mob2 T C 7: 142,009,537 probably null Het
Nckap5 T A 1: 126,222,673 H105L possibly damaging Het
Ngef C A 1: 87,509,368 G133* probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1000 T C 2: 85,608,447 I154M probably benign Het
Olfr113 T G 17: 37,575,220 I68L probably benign Het
Olfr1477 G T 19: 13,502,384 V14F possibly damaging Het
Olfr31 T A 14: 14,328,462 M117K probably damaging Het
Olfr593 G A 7: 103,212,000 V47I probably benign Het
Pard3 A G 8: 127,073,290 probably null Het
Pgm1 C T 5: 64,105,832 A274V possibly damaging Het
Ppp1r9a T A 6: 5,156,177 S1144R probably damaging Het
Prkcq C T 2: 11,299,416 P590L probably damaging Het
Psmd13 T A 7: 140,894,461 probably null Het
Rab3gap1 T A 1: 127,889,194 D63E probably benign Het
Rag2 C A 2: 101,630,740 T465K probably damaging Het
Rnase6 A G 14: 51,130,213 M21V unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,638,430 probably null Het
Sash1 T G 10: 8,740,225 R624S probably damaging Het
Slc1a2 A G 2: 102,756,115 I355V probably benign Het
Sugct C T 13: 17,323,276 A271T probably damaging Het
Tdrd7 T C 4: 46,034,350 V1065A probably damaging Het
Tmprss6 T A 15: 78,454,189 Y307F probably damaging Het
Tram1 T C 1: 13,571,902 N216S probably benign Het
Ttk T C 9: 83,839,341 V93A probably benign Het
Ubr4 A G 4: 139,468,097 Y1210C probably damaging Het
Wdr7 A G 18: 63,738,866 K364E probably benign Het
Xrcc2 G T 5: 25,692,658 H98N probably benign Het
Zdhhc11 A G 13: 73,965,569 I77V probably benign Het
Zfp54 C T 17: 21,434,180 S312L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCAAACTTGGCCAGATACTTC -3'
(R):5'- GTACTGTGGAAGACTCAGGC -3'

Sequencing Primer
(F):5'- TTGGCCAGATACTTCAAGTCCAG -3'
(R):5'- TACTGTGGAAGACTCAGGCCTATC -3'
Posted On2016-07-06