Incidental Mutation 'R5198:Gdpd5'
ID400477
Institutional Source Beutler Lab
Gene Symbol Gdpd5
Ensembl Gene ENSMUSG00000035314
Gene Nameglycerophosphodiester phosphodiesterase domain containing 5
SynonymsGde2
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99381414-99461877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99438308 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 60 (Y60N)
Ref Sequence ENSEMBL: ENSMUSP00000150361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037528] [ENSMUST00000208800] [ENSMUST00000213887]
Predicted Effect probably damaging
Transcript: ENSMUST00000037528
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036175
Gene: ENSMUSG00000035314
AA Change: Y60N

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 127 146 N/A INTRINSIC
transmembrane domain 161 180 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Pfam:GDPD 233 380 9.8e-17 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207238
Predicted Effect probably damaging
Transcript: ENSMUST00000208800
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213887
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycerophosphodiester phosphodiesterases (GDPDs; EC 3.1.4.46), such as GDPD5, are involved in glycerol metabolism (Lang et al., 2008 [PubMed 17578682]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired motor neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rfx3 T C 19: 27,830,776 D189G probably damaging Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Gdpd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03291:Gdpd5 APN 7 99460121 utr 3 prime probably benign
R0149:Gdpd5 UTSW 7 99458790 missense possibly damaging 0.49
R0361:Gdpd5 UTSW 7 99458790 missense possibly damaging 0.49
R0811:Gdpd5 UTSW 7 99438333 missense probably damaging 1.00
R0812:Gdpd5 UTSW 7 99438333 missense probably damaging 1.00
R1633:Gdpd5 UTSW 7 99448513 missense probably benign
R1864:Gdpd5 UTSW 7 99448999 missense probably benign 0.04
R1885:Gdpd5 UTSW 7 99459997 missense probably benign 0.29
R2099:Gdpd5 UTSW 7 99448489 missense probably damaging 1.00
R3776:Gdpd5 UTSW 7 99454572 missense probably benign 0.04
R3913:Gdpd5 UTSW 7 99438339 missense probably null 0.23
R5318:Gdpd5 UTSW 7 99453027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGGTTTGGTCCTCTTTGAGC -3'
(R):5'- ACGTCTCCTCCTCCAGAAAG -3'

Sequencing Primer
(F):5'- CCTCAGCTCCTGGCAGTTGAG -3'
(R):5'- GTCTTACCAGACTGTGACAGGAC -3'
Posted On2016-07-06