Incidental Mutation 'R5238:Bclaf1'
ID400515
Institutional Source Beutler Lab
Gene Symbol Bclaf1
Ensembl Gene ENSMUSG00000037608
Gene NameBCL2-associated transcription factor 1
Synonyms5730534O06Rik, 2810454G14Rik, 2700025J07Rik, 2610102K23Rik
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location20312469-20344613 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 20332384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043881] [ENSMUST00000092678] [ENSMUST00000185800] [ENSMUST00000186100] [ENSMUST00000189158] [ENSMUST00000190156] [ENSMUST00000191438]
Predicted Effect probably benign
Transcript: ENSMUST00000043881
SMART Domains Protein: ENSMUSP00000043583
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 766 1.6e-181 PFAM
low complexity region 793 824 N/A INTRINSIC
low complexity region 861 874 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092678
SMART Domains Protein: ENSMUSP00000090349
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 789 5.4e-191 PFAM
low complexity region 812 825 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185800
SMART Domains Protein: ENSMUSP00000140623
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 787 7.2e-191 PFAM
low complexity region 791 822 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186100
SMART Domains Protein: ENSMUSP00000140101
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 94 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 108 742 6.4e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188546
Predicted Effect probably benign
Transcript: ENSMUST00000189158
Predicted Effect probably benign
Transcript: ENSMUST00000190156
SMART Domains Protein: ENSMUSP00000140428
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
low complexity region 3 92 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 106 740 4.2e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191143
Predicted Effect probably benign
Transcript: ENSMUST00000191438
SMART Domains Protein: ENSMUSP00000140702
Gene: ENSMUSG00000037608

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 502 1.3e-140 PFAM
low complexity region 525 538 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, impaired lung development, and T cell and B cell homeostasis abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Bclaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bclaf1 APN 10 20325999 missense probably damaging 0.99
IGL01087:Bclaf1 APN 10 20325310 missense probably damaging 0.99
IGL02001:Bclaf1 APN 10 20323016 unclassified probably benign
IGL02380:Bclaf1 APN 10 20325367 missense possibly damaging 0.93
IGL02618:Bclaf1 APN 10 20323528 missense probably damaging 1.00
R0629:Bclaf1 UTSW 10 20333426 missense probably damaging 1.00
R0884:Bclaf1 UTSW 10 20322076 nonsense probably null
R1013:Bclaf1 UTSW 10 20332076 splice site probably benign
R1611:Bclaf1 UTSW 10 20323252 unclassified probably benign
R2228:Bclaf1 UTSW 10 20339878 utr 3 prime probably benign
R3689:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R3690:Bclaf1 UTSW 10 20325397 missense possibly damaging 0.84
R4290:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4292:Bclaf1 UTSW 10 20323778 missense probably damaging 1.00
R4831:Bclaf1 UTSW 10 20322126 unclassified probably benign
R5254:Bclaf1 UTSW 10 20323536 missense possibly damaging 0.71
R5354:Bclaf1 UTSW 10 20333532 missense probably damaging 1.00
R5386:Bclaf1 UTSW 10 20325592 missense possibly damaging 0.95
R5712:Bclaf1 UTSW 10 20333531 missense probably damaging 1.00
R5982:Bclaf1 UTSW 10 20323063 nonsense probably null
R6147:Bclaf1 UTSW 10 20323425 missense possibly damaging 0.93
R6218:Bclaf1 UTSW 10 20334628 missense probably benign 0.27
R6284:Bclaf1 UTSW 10 20322160 intron probably null
R6738:Bclaf1 UTSW 10 20323769 missense possibly damaging 0.91
R7085:Bclaf1 UTSW 10 20322022 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATTGACCGTCGCCGTAAAG -3'
(R):5'- ACTGTTTCTAGAAATGCACTGC -3'

Sequencing Primer
(F):5'- TCCAGTGGGTCCAGAAAGC -3'
(R):5'- CATTGAAGTCCAACCTCCTGATGTAG -3'
Posted On2016-07-06