Incidental Mutation 'R5198:Rfx3'
ID400529
Institutional Source Beutler Lab
Gene Symbol Rfx3
Ensembl Gene ENSMUSG00000040929
Gene Nameregulatory factor X, 3 (influences HLA class II expression)
SynonymsC230093O12Rik, MRFX3
MMRRC Submission 042774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5198 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27761721-28011166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27830776 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000133461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174850]
Predicted Effect probably damaging
Transcript: ENSMUST00000046898
AA Change: D164G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: D164G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 6.3e-58 PFAM
Pfam:RFX_DNA_binding 150 235 6.9e-41 PFAM
low complexity region 274 283 N/A INTRINSIC
internal_repeat_1 326 414 1.39e-5 PROSPERO
internal_repeat_1 439 527 1.39e-5 PROSPERO
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165566
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: D189G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 138 9.7e-38 PFAM
Pfam:RFX_DNA_binding 181 258 6.2e-36 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172498
Predicted Effect probably damaging
Transcript: ENSMUST00000172907
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: D189G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173161
Predicted Effect probably damaging
Transcript: ENSMUST00000173863
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929
AA Change: D189G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 3.3e-58 PFAM
Pfam:RFX_DNA_binding 175 246 3.7e-24 PFAM
low complexity region 285 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174850
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: D189G

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik G A 2: 23,212,461 C121Y probably damaging Het
Abcc9 A G 6: 142,626,000 V1121A probably benign Het
Adamtsl3 A C 7: 82,611,798 K1647Q possibly damaging Het
Adgrb1 A T 15: 74,543,701 Q710L probably null Het
Alox12 T C 11: 70,254,417 E110G probably damaging Het
Cep152 T A 2: 125,587,624 M738L probably benign Het
Cma2 T C 14: 55,972,075 V38A probably benign Het
Dlc1 C T 8: 36,938,398 G79D probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dus3l A G 17: 56,769,574 I585V probably benign Het
Etl4 A G 2: 20,713,387 Y313C probably damaging Het
Fbxw15 C A 9: 109,558,174 S251I probably benign Het
Gata4 G A 14: 63,200,451 S417L probably benign Het
Gdpd5 T A 7: 99,438,308 Y60N probably damaging Het
Gm17669 T C 18: 67,562,556 M57T probably benign Het
Gpr39 A T 1: 125,677,436 I34F probably benign Het
Iffo2 T A 4: 139,575,217 D90E probably benign Het
Il17c A G 8: 122,422,369 D84G possibly damaging Het
Itih3 T C 14: 30,912,649 T134A probably benign Het
Lama2 G A 10: 27,347,003 A429V probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mug1 G A 6: 121,874,562 R806H probably damaging Het
Naaa G A 5: 92,268,045 R65* probably null Het
Nacc2 C T 2: 26,060,334 M463I probably benign Het
Nemf A G 12: 69,356,047 S72P probably damaging Het
Nudt7 G A 8: 114,135,445 probably null Het
Olfr1272 T C 2: 90,296,393 Q156R probably damaging Het
Olfr625-ps1 T C 7: 103,682,729 S4P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T C 19: 5,139,297 D757G probably benign Het
Pkd2 A C 5: 104,483,092 I461L probably benign Het
Pramel5 T G 4: 144,273,494 probably benign Het
Ptgdr G C 14: 44,858,843 F137L probably damaging Het
Pum1 T A 4: 130,779,879 C1085* probably null Het
Rlf T A 4: 121,148,553 K1077* probably null Het
Slc25a30 C A 14: 75,769,616 D147Y probably benign Het
Smap2 T C 4: 121,016,787 E22G possibly damaging Het
Szt2 T C 4: 118,388,322 T1098A probably benign Het
Tbcc T C 17: 46,890,862 F58S probably damaging Het
Tekt3 G A 11: 63,070,308 R101H probably damaging Het
Vcan T A 13: 89,690,872 E2184D probably damaging Het
Vkorc1 T C 7: 127,894,588 E18G probably benign Het
Vmn1r68 T C 7: 10,527,796 H125R probably benign Het
Vmn2r63 C A 7: 42,903,745 V696L probably benign Het
Wdr59 G A 8: 111,481,988 H421Y probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp112 T C 7: 24,124,856 V83A possibly damaging Het
Zfp616 G A 11: 74,083,510 V293I probably benign Het
Other mutations in Rfx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Rfx3 APN 19 27806186 critical splice donor site probably null
IGL00588:Rfx3 APN 19 27826076 nonsense probably null
IGL01408:Rfx3 APN 19 27768650 missense probably benign 0.04
IGL01937:Rfx3 APN 19 27830729 missense probably damaging 1.00
IGL02668:Rfx3 APN 19 27815614 splice site probably benign
IGL02679:Rfx3 APN 19 27849737 missense possibly damaging 0.95
R0267:Rfx3 UTSW 19 27793788 missense probably benign 0.00
R0336:Rfx3 UTSW 19 27806262 missense probably benign 0.00
R0838:Rfx3 UTSW 19 27849967 missense possibly damaging 0.92
R0967:Rfx3 UTSW 19 27806351 splice site probably benign
R1102:Rfx3 UTSW 19 27867600 missense possibly damaging 0.51
R1507:Rfx3 UTSW 19 27768513 missense probably benign 0.00
R2172:Rfx3 UTSW 19 27815494 nonsense probably null
R2844:Rfx3 UTSW 19 27806786 splice site probably benign
R2960:Rfx3 UTSW 19 27900811 nonsense probably null
R4291:Rfx3 UTSW 19 27800232 missense probably damaging 1.00
R4952:Rfx3 UTSW 19 27830672 missense probably damaging 1.00
R5451:Rfx3 UTSW 19 27849959 missense probably damaging 1.00
R5590:Rfx3 UTSW 19 27802380 critical splice donor site probably null
R5641:Rfx3 UTSW 19 27793608 splice site probably null
R5663:Rfx3 UTSW 19 27793617 missense probably damaging 1.00
R5899:Rfx3 UTSW 19 27830765 missense probably damaging 1.00
R6049:Rfx3 UTSW 19 27802395 missense probably damaging 0.99
R6368:Rfx3 UTSW 19 27768609 missense possibly damaging 0.92
R7131:Rfx3 UTSW 19 27768628 nonsense probably null
R7273:Rfx3 UTSW 19 27802458 missense probably damaging 1.00
Z1088:Rfx3 UTSW 19 27837450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCTCTAATAGAATCAGAGAG -3'
(R):5'- ACTGATAACTGCTGTGATGTTTCC -3'

Sequencing Primer
(F):5'- GTCGACTGTCAGTACTAACCTAGTG -3'
(R):5'- ATAACTGCTGTGATGTTTCCCATATC -3'
Posted On2016-07-06