Incidental Mutation 'R5238:Abhd12b'
ID400534
Institutional Source Beutler Lab
Gene Symbol Abhd12b
Ensembl Gene ENSMUSG00000090121
Gene Nameabhydrolase domain containing 12B
SynonymsLOC328121
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70154142-70183887 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 70163368 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169156] [ENSMUST00000182512] [ENSMUST00000182782] [ENSMUST00000182927]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162570
Predicted Effect probably null
Transcript: ENSMUST00000169156
SMART Domains Protein: ENSMUSP00000134568
Gene: ENSMUSG00000090121

DomainStartEndE-ValueType
Pfam:Hydrolase_4 136 289 1e-16 PFAM
Pfam:Abhydrolase_1 137 278 2.6e-10 PFAM
Pfam:Abhydrolase_5 138 337 3.5e-22 PFAM
Pfam:Abhydrolase_6 139 347 2.1e-12 PFAM
Pfam:Peptidase_S9 154 357 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182512
Predicted Effect probably benign
Transcript: ENSMUST00000182782
Predicted Effect probably null
Transcript: ENSMUST00000182927
SMART Domains Protein: ENSMUSP00000138681
Gene: ENSMUSG00000090121

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 61 260 1.5e-22 PFAM
Pfam:Abhydrolase_6 62 266 1.8e-19 PFAM
Pfam:Peptidase_S9 77 280 5.1e-8 PFAM
Pfam:Abhydrolase_1 89 279 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Col20a1 T C 2: 180,998,586 V512A probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Abhd12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Abhd12b APN 12 70169048 missense probably damaging 0.99
IGL02886:Abhd12b APN 12 70182966 missense possibly damaging 0.70
ANU23:Abhd12b UTSW 12 70169048 missense probably damaging 0.99
R0112:Abhd12b UTSW 12 70181017 missense probably benign 0.16
R0542:Abhd12b UTSW 12 70163495 missense possibly damaging 0.82
R1427:Abhd12b UTSW 12 70182419 missense probably damaging 1.00
R4782:Abhd12b UTSW 12 70169064 missense probably damaging 1.00
R4799:Abhd12b UTSW 12 70169064 missense probably damaging 1.00
R5372:Abhd12b UTSW 12 70181026 missense probably damaging 0.98
R6974:Abhd12b UTSW 12 70159447 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTCGCAGTAGCAATTTTCCTC -3'
(R):5'- GATTGAAAACTGCCTTCACTCTCC -3'

Sequencing Primer
(F):5'- AGCAATTTTCCTCTGATATTTTGTGC -3'
(R):5'- ACTCTCCCATGGCTTAGAAATG -3'
Posted On2016-07-06