Incidental Mutation 'R5239:Brinp2'
ID400563
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
MMRRC Submission 042810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5239 (G1)
Quality Score212
Status Validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158251338 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 305 (E305G)
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect probably benign
Transcript: ENSMUST00000004133
AA Change: E305G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: E305G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,836 N168S probably benign Het
Adam3 T A 8: 24,694,191 T598S possibly damaging Het
Ago1 G T 4: 126,441,215 H405N probably damaging Het
Atp8b4 T C 2: 126,392,861 probably null Het
Baz1a A G 12: 54,898,344 S1409P probably damaging Het
Bub1 T A 2: 127,821,696 R262W probably damaging Het
Cish T A 9: 107,299,912 probably null Het
Clip4 T A 17: 71,799,077 I85K probably damaging Het
Cpsf2 T A 12: 101,987,273 C187* probably null Het
Ddx51 C A 5: 110,653,648 T54K probably benign Het
Drc1 A T 5: 30,363,123 T603S probably benign Het
Eif3l T A 15: 79,089,795 M470K possibly damaging Het
Entpd2 A G 2: 25,400,818 T445A probably damaging Het
Epha1 C A 6: 42,365,010 V369L possibly damaging Het
Galnt9 T A 5: 110,544,769 L23H probably damaging Het
Gm1110 A G 9: 26,893,570 F399S probably benign Het
Gm43972 G A 5: 25,661,121 noncoding transcript Het
Gm6489 T A 1: 31,287,270 noncoding transcript Het
Grik5 A T 7: 25,065,470 M82K probably damaging Het
Hibch T C 1: 52,865,608 Y121H probably damaging Het
Hyou1 T A 9: 44,385,263 I495N possibly damaging Het
Il1rl2 T C 1: 40,365,095 S459P probably benign Het
Kel A T 6: 41,688,114 L254* probably null Het
Lasp1 A G 11: 97,799,860 K23E probably damaging Het
Lemd2 C A 17: 27,203,799 R207L possibly damaging Het
Mum1 C T 10: 80,228,421 R14* probably null Het
Myh1 A T 11: 67,215,225 Q1222L probably benign Het
Myh2 G A 11: 67,192,443 V1411I probably benign Het
Myo1f T C 17: 33,601,735 F851L probably benign Het
Myom3 G A 4: 135,800,992 probably benign Het
Nbas C A 12: 13,441,518 L1464I probably benign Het
Nr2e3 G T 9: 59,949,776 probably benign Het
Nrxn1 T C 17: 90,704,109 D364G probably damaging Het
Olfr1015 T G 2: 85,785,658 I49S probably damaging Het
Olfr1385 A G 11: 49,494,728 H65R possibly damaging Het
Olfr493 T A 7: 108,346,646 T112S probably benign Het
Olfr969 T A 9: 39,796,196 S274T probably damaging Het
Otog T A 7: 46,287,435 S1523T probably benign Het
Pcnx2 A T 8: 125,861,082 probably null Het
Pkdcc C A 17: 83,215,984 H173Q probably damaging Het
Pkn1 A G 8: 83,684,182 L267P probably damaging Het
Polr1a A G 6: 71,913,037 H80R probably damaging Het
Rag1 G T 2: 101,642,955 A614E possibly damaging Het
Ryr1 T C 7: 29,036,128 D4075G probably damaging Het
Sdk2 C A 11: 113,868,033 R455L probably damaging Het
Smoc2 A G 17: 14,368,965 N232S probably benign Het
Snd1 T C 6: 28,545,525 L360P probably damaging Het
Tmem26 T A 10: 68,751,266 F181L probably damaging Het
Tnrc6a A G 7: 123,186,619 M1512V probably benign Het
Tsc22d1 T A 14: 76,418,412 I20N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r122 T C 7: 21,134,098 T11A possibly damaging Het
Vpreb1 A T 16: 16,868,728 Y99* probably null Het
Wnt9b A T 11: 103,731,228 probably null Het
Zfp143 A G 7: 110,094,352 E604G probably damaging Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1892:Brinp2 UTSW 1 158254972 critical splice donor site probably null
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5537:Brinp2 UTSW 1 158255013 missense probably damaging 0.97
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R5922:Brinp2 UTSW 1 158249355 missense possibly damaging 0.79
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R6999:Brinp2 UTSW 1 158251305 missense probably benign 0.20
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7376:Brinp2 UTSW 1 158251368 missense probably damaging 0.98
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGTCAGACTCCTCATTTTCTAG -3'
(R):5'- ACAGAGTCATTCTTCCGCCC -3'

Sequencing Primer
(F):5'- AGACTCCTCATTTTCTAGCTCTGTAC -3'
(R):5'- ACACACTGGTTCTGCTCACTGAC -3'
Posted On2016-07-06