Incidental Mutation 'R5200:Cfap45'
ID400646
Institutional Source Beutler Lab
Gene Symbol Cfap45
Ensembl Gene ENSMUSG00000026546
Gene Namecilia and flagella associated protein 45
Synonyms1700028D05Rik, Nesg1, Ccdc19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172520801-172545870 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 172545129 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 464 (Q464*)
Ref Sequence ENSEMBL: ENSMUSP00000083057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085894] [ENSMUST00000160303]
Predicted Effect probably null
Transcript: ENSMUST00000085894
AA Change: Q464*
SMART Domains Protein: ENSMUSP00000083057
Gene: ENSMUSG00000026546
AA Change: Q464*

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:TPH 187 532 1.5e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140307
Predicted Effect probably benign
Transcript: ENSMUST00000160303
SMART Domains Protein: ENSMUSP00000124646
Gene: ENSMUSG00000026546

DomainStartEndE-ValueType
Pfam:Trichoplein 1 64 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169111
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Shc3 T C 13: 51,516,565 M49V probably damaging Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Cfap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cfap45 APN 1 172535345 unclassified probably benign
IGL01936:Cfap45 APN 1 172534049 missense probably damaging 1.00
IGL03235:Cfap45 APN 1 172538493 missense possibly damaging 0.55
R0194:Cfap45 UTSW 1 172541327 missense probably benign 0.05
R0883:Cfap45 UTSW 1 172532189 missense possibly damaging 0.90
R1130:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1168:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1356:Cfap45 UTSW 1 172527863 missense possibly damaging 0.53
R1522:Cfap45 UTSW 1 172540572 missense probably damaging 1.00
R1921:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R1922:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R2203:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2204:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2205:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R3156:Cfap45 UTSW 1 172545724 missense possibly damaging 0.93
R4059:Cfap45 UTSW 1 172538489 missense probably benign 0.00
R4151:Cfap45 UTSW 1 172532221 missense probably damaging 0.98
R4445:Cfap45 UTSW 1 172535227 missense probably benign 0.07
R4548:Cfap45 UTSW 1 172545108 missense probably benign 0.00
R4582:Cfap45 UTSW 1 172529912 missense probably benign 0.42
R4909:Cfap45 UTSW 1 172529876 missense probably benign 0.14
R5800:Cfap45 UTSW 1 172538600 missense probably damaging 0.98
R6520:Cfap45 UTSW 1 172540584 missense probably damaging 1.00
R6662:Cfap45 UTSW 1 172529850 missense probably benign 0.01
R7390:Cfap45 UTSW 1 172541358 missense probably benign 0.00
R7468:Cfap45 UTSW 1 172535310 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGTATTTGGGTCTGTCCG -3'
(R):5'- ACGTCACCTCTTTGGGAAAG -3'

Sequencing Primer
(F):5'- TCTGTCCGGGGAGAGGAG -3'
(R):5'- AGCGCACCTCAGCTCTTC -3'
Posted On2016-07-06