Incidental Mutation 'R5201:Actn4'
ID400793
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Nameactinin alpha 4
Synonyms
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28893248-28962340 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 28916255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000068045] [ENSMUST00000068045] [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000127210] [ENSMUST00000127210] [ENSMUST00000127210] [ENSMUST00000140622] [ENSMUST00000140622] [ENSMUST00000140622] [ENSMUST00000140622] [ENSMUST00000148196] [ENSMUST00000148196] [ENSMUST00000148196] [ENSMUST00000148196] [ENSMUST00000217157] [ENSMUST00000217157] [ENSMUST00000217157] [ENSMUST00000217157]
Predicted Effect probably null
Transcript: ENSMUST00000068045
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068045
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068045
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068045
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208229
Predicted Effect probably null
Transcript: ENSMUST00000217157
Predicted Effect probably null
Transcript: ENSMUST00000217157
Predicted Effect probably null
Transcript: ENSMUST00000217157
Predicted Effect probably null
Transcript: ENSMUST00000217157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28904684 missense probably damaging 1.00
IGL02127:Actn4 APN 7 28897880 missense probably benign
IGL02192:Actn4 APN 7 28898400 missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28912234 splice site probably benign
IGL03339:Actn4 APN 7 28901982 missense probably damaging 1.00
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28905398 missense probably benign 0.29
R0689:Actn4 UTSW 7 28897049 missense probably damaging 1.00
R0845:Actn4 UTSW 7 28913430 missense probably damaging 1.00
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1469:Actn4 UTSW 7 28898266 splice site probably benign
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1581:Actn4 UTSW 7 28898646 missense probably benign 0.04
R1690:Actn4 UTSW 7 28911525 missense probably damaging 1.00
R1962:Actn4 UTSW 7 28894622 missense probably damaging 1.00
R2113:Actn4 UTSW 7 28898124 missense probably benign 0.42
R2215:Actn4 UTSW 7 28918753 missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28898071 missense probably benign 0.00
R3945:Actn4 UTSW 7 28912236 splice site probably null
R3962:Actn4 UTSW 7 28898222 unclassified probably null
R3970:Actn4 UTSW 7 28962032 missense probably benign
R4909:Actn4 UTSW 7 28898657 missense probably damaging 1.00
R4985:Actn4 UTSW 7 28918986 missense probably damaging 1.00
R5155:Actn4 UTSW 7 28962017 critical splice donor site probably null
R5668:Actn4 UTSW 7 28904550 missense probably damaging 1.00
R5818:Actn4 UTSW 7 28919019 missense probably damaging 1.00
R6046:Actn4 UTSW 7 28904619 missense probably benign 0.03
R6155:Actn4 UTSW 7 28896141 missense probably damaging 1.00
R6559:Actn4 UTSW 7 28907036 missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28962084 missense probably benign 0.08
R7225:Actn4 UTSW 7 28898699 missense probably damaging 1.00
R7423:Actn4 UTSW 7 28894255 missense probably damaging 0.97
Z1088:Actn4 UTSW 7 28894578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTGTATGAAATAGAGGCC -3'
(R):5'- CTGGCCAATGCAGAAAAGGC -3'

Sequencing Primer
(F):5'- TAGAGGCCACAGAGCACTGC -3'
(R):5'- CCAATGCAGAAAAGGCCTTTGTG -3'
Posted On2016-07-06