Incidental Mutation 'R5201:Otx1'
ID400809
Institutional Source Beutler Lab
Gene Symbol Otx1
Ensembl Gene ENSMUSG00000005917
Gene Nameorthodenticle homeobox 1
SynonymsA730044F23Rik, jv
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R5201 (G1)
Quality Score186
Status Not validated
Chromosome11
Chromosomal Location21994764-22002897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21997037 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 91 (A91S)
Ref Sequence ENSEMBL: ENSMUSP00000134704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]
Predicted Effect probably damaging
Transcript: ENSMUST00000006071
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
Pfam:TF_Otx 178 279 2.5e-39 PFAM
internal_repeat_1 310 322 1.39e-7 PROSPERO
low complexity region 324 331 N/A INTRINSIC
internal_repeat_1 334 346 1.39e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000147486
AA Change: A91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: A91S

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172395
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Otx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Otx1 APN 11 21996794 unclassified probably benign
embarrassed UTSW 11 21997037 missense probably damaging 1.00
R1946:Otx1 UTSW 11 21998482 missense probably damaging 1.00
R2291:Otx1 UTSW 11 21996634 unclassified probably benign
R2870:Otx1 UTSW 11 21998681 intron probably benign
R4164:Otx1 UTSW 11 21996638 unclassified probably benign
R4845:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4925:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4934:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4993:Otx1 UTSW 11 21998532 splice site probably null
R5061:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5062:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5063:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5068:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5069:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5070:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5097:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5169:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5170:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5171:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5172:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5198:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5199:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5200:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5202:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5203:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5204:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5205:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5256:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5267:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5360:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5361:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5363:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5372:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5375:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5380:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5381:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5382:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5383:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5415:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5416:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5534:Otx1 UTSW 11 21996296 unclassified probably benign
R5592:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5594:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5725:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5727:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5735:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5736:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5841:Otx1 UTSW 11 21998594 intron probably benign
R5940:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5941:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6080:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6081:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6093:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6126:Otx1 UTSW 11 21996457 unclassified probably benign
R6131:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6132:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6134:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6187:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6220:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6269:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6270:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6271:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6272:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6396:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6619:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6624:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6680:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6681:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6718:Otx1 UTSW 11 21996412 unclassified probably benign
R6831:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6834:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6985:Otx1 UTSW 11 21996615 nonsense probably null
X0054:Otx1 UTSW 11 21996331 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGATGGACGAAGCAGTAG -3'
(R):5'- TTACTAGGGGTTTGCGCAGAAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGACGCTGCTG -3'
(R):5'- TTTGCGCAGAAGGATGGG -3'
Posted On2016-07-06