Incidental Mutation 'R5201:Hira'
ID400829
Institutional Source Beutler Lab
Gene Symbol Hira
Ensembl Gene ENSMUSG00000022702
Gene Namehistone cell cycle regulator
SynonymsD16Ertd95e, Gm15797, Tuple1
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18877037-18970309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18952115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 834 (V834A)
Ref Sequence ENSEMBL: ENSMUSP00000004222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000190050]
Predicted Effect probably damaging
Transcript: ENSMUST00000004222
AA Change: V834A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: V834A

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150799
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232419
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Hira
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Hira APN 16 18946340 splice site probably benign
IGL01285:Hira APN 16 18912180 missense probably benign 0.01
F5770:Hira UTSW 16 18894821 missense probably damaging 1.00
IGL02796:Hira UTSW 16 18925654 missense probably benign 0.01
R0123:Hira UTSW 16 18956171 missense probably benign 0.45
R0225:Hira UTSW 16 18956171 missense probably benign 0.45
R0606:Hira UTSW 16 18935047 missense probably benign 0.00
R1017:Hira UTSW 16 18899347 intron probably null
R1456:Hira UTSW 16 18925663 missense probably benign 0.02
R1479:Hira UTSW 16 18896469 missense probably damaging 1.00
R1731:Hira UTSW 16 18933014 missense probably benign 0.01
R1830:Hira UTSW 16 18947414 missense probably damaging 1.00
R2039:Hira UTSW 16 18951701 missense probably benign 0.05
R4328:Hira UTSW 16 18896612 missense probably benign 0.01
R4401:Hira UTSW 16 18925720 missense probably damaging 1.00
R4423:Hira UTSW 16 18956202 missense possibly damaging 0.80
R4634:Hira UTSW 16 18946400 missense probably damaging 0.98
R4728:Hira UTSW 16 18922904 missense probably damaging 1.00
R5050:Hira UTSW 16 18925859 missense possibly damaging 0.75
R5139:Hira UTSW 16 18954758 missense probably damaging 1.00
R5327:Hira UTSW 16 18954758 missense probably damaging 1.00
R5483:Hira UTSW 16 18969540 missense possibly damaging 0.89
R5573:Hira UTSW 16 18916599 missense probably damaging 1.00
R5626:Hira UTSW 16 18927512 missense probably damaging 0.97
R5768:Hira UTSW 16 18935018 splice site probably benign
R5952:Hira UTSW 16 18935065 missense possibly damaging 0.83
R6128:Hira UTSW 16 18932977 missense probably benign 0.08
R6280:Hira UTSW 16 18910707 missense probably damaging 1.00
R7116:Hira UTSW 16 18912114 missense probably damaging 1.00
R7363:Hira UTSW 16 18897782 missense possibly damaging 0.64
V7581:Hira UTSW 16 18894821 missense probably damaging 1.00
V7582:Hira UTSW 16 18894821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTACAGAGATCCTGATGG -3'
(R):5'- ATACAGGAGTTGGTGAGAGTTC -3'

Sequencing Primer
(F):5'- GTTATCAGAATGGCTTGGCTAAAG -3'
(R):5'- TTGGTGAGAGTTCAAAAGAAGC -3'
Posted On2016-07-06