Incidental Mutation 'R5202:Gria4'
ID400903
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R5202 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4424330 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 845 (K845R)
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
Predicted Effect probably benign
Transcript: ENSMUST00000027020
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: K845R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
AA Change: K845R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: K845R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212533
AA Change: K845R

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Alcam T C 16: 52,274,236 Y384C probably damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Bfsp1 T C 2: 143,826,971 S569G probably benign Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Fzd10 T C 5: 128,602,116 V300A possibly damaging Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr297 C A 7: 86,527,116 R120S probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Tnks2 G A 19: 36,888,852 G1080R probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCGTGTTCACAGGATGCATC -3'
(R):5'- CCTGCATCAGCGACTTATACC -3'

Sequencing Primer
(F):5'- GATGCATCCCCCGCTCAC -3'
(R):5'- GGCTATTTGGATATTATGCATCCC -3'
Posted On2016-07-06