Incidental Mutation 'R0408:Abcc8'
ID40093
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 038610-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R0408 (G1)
Quality Score84
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46107033 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1416 (I1416T)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably damaging
Transcript: ENSMUST00000033123
AA Change: I1416T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: I1416T

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: I737T
Predicted Effect probably benign
Transcript: ENSMUST00000210770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211039
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,853,446 N1032K probably damaging Het
Aco2 T C 15: 81,913,118 probably null Het
Akap13 C T 7: 75,746,796 L2514F probably damaging Het
Aldh1a3 A G 7: 66,406,050 V331A probably damaging Het
Arid3a T A 10: 79,950,833 D473E probably benign Het
Atg9a A G 1: 75,185,295 S536P probably damaging Het
Atxn7 A T 14: 14,100,317 S668C probably damaging Het
Bcar3 A T 3: 122,508,384 I243F probably damaging Het
Bend6 G A 1: 33,862,753 P183S probably damaging Het
Bfsp2 A T 9: 103,480,100 S43T probably benign Het
Camk4 G A 18: 33,129,792 D136N probably damaging Het
Ceacam3 G T 7: 17,151,883 probably benign Het
Chrm3 T C 13: 9,877,933 I356V probably benign Het
Clec9a T A 6: 129,419,569 I133N possibly damaging Het
Ctnnd2 T C 15: 30,634,677 L157P probably damaging Het
Ddhd2 T C 8: 25,739,587 probably null Het
Def8 T C 8: 123,459,917 V436A probably damaging Het
Dock10 T C 1: 80,540,476 K1293R probably benign Het
Dync1h1 T G 12: 110,631,692 D1772E probably benign Het
Ephx4 G T 5: 107,413,521 G72C probably damaging Het
Fam136a T G 6: 86,366,725 V68G possibly damaging Het
Fam69c T A 18: 84,720,363 probably null Het
Fcgrt T C 7: 45,101,939 E195G probably damaging Het
Fut9 T A 4: 25,620,319 Q165L possibly damaging Het
Glb1l T C 1: 75,208,835 Y77C probably damaging Het
Gm16286 T C 18: 80,211,814 S108P probably damaging Het
Gpr26 T C 7: 131,967,520 V198A possibly damaging Het
Gpr26 C A 7: 131,974,272 probably null Het
Gsdma3 A C 11: 98,635,338 E296A probably benign Het
Hyou1 G T 9: 44,384,692 G385W probably damaging Het
Il17rb T C 14: 29,996,680 S482G probably benign Het
Itgb4 A T 11: 116,007,602 R1715W probably damaging Het
Jak2 A G 19: 29,286,317 S411G probably benign Het
Kdm3a C T 6: 71,611,679 D449N probably benign Het
Kif1bp T C 10: 62,566,053 I23M probably benign Het
Klhl26 T C 8: 70,452,480 D226G probably damaging Het
Klra1 T A 6: 130,377,774 I94F probably benign Het
Lama3 A G 18: 12,456,837 D808G probably benign Het
Lrp1b C T 2: 40,677,591 M272I probably damaging Het
Masp2 A G 4: 148,606,039 D251G probably benign Het
Mob3b T C 4: 35,083,991 D66G probably damaging Het
Myo7a T C 7: 98,056,781 Q1863R probably damaging Het
Olfr119 G A 17: 37,701,299 V210I probably benign Het
Olfr1195 A T 2: 88,683,655 F26I probably benign Het
Pdgfd T A 9: 6,293,928 Y167* probably null Het
Pfas A G 11: 69,001,105 probably null Het
Plin1 T A 7: 79,722,646 T393S probably damaging Het
Prdm15 A T 16: 97,835,786 N110K possibly damaging Het
Prune2 T A 19: 17,122,310 V1726D probably benign Het
Sestd1 T A 2: 77,191,793 D518V probably damaging Het
Setd2 C T 9: 110,594,242 P344S probably damaging Het
Slc22a1 A T 17: 12,656,941 I462N probably damaging Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d14 G T 5: 36,571,299 T241K possibly damaging Het
Uaca T C 9: 60,871,859 L1176P possibly damaging Het
Ube2g1 G C 11: 72,672,965 G52A probably damaging Het
Utrn A G 10: 12,384,190 *957R probably null Het
Vmn2r125 A T 4: 156,350,858 E177V probably damaging Het
Vmn2r86 A G 10: 130,446,854 F631S probably damaging Het
Zc3h13 T A 14: 75,292,186 C42* probably null Het
Zc3h14 T G 12: 98,763,823 V13G probably damaging Het
Zfat A T 15: 68,180,292 V551D probably benign Het
Zfp618 C T 4: 63,086,572 R70W probably damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGTTCATCTTCATCGCCAAAGC -3'
(R):5'- TGTGTTAACTGTCACACACGCACC -3'

Sequencing Primer
(F):5'- ATGCTGGCTTACGCCTAATGAG -3'
(R):5'- ACCACCCATGTGCCCAC -3'
Posted On2013-05-23