Incidental Mutation 'R5202:Tnks2'
ID400951
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms
MMRRC Submission 042777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5202 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36834232-36893477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36888852 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1080 (G1080R)
Ref Sequence ENSEMBL: ENSMUSP00000025729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729] [ENSMUST00000164665]
Predicted Effect probably damaging
Transcript: ENSMUST00000025729
AA Change: G1080R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811
AA Change: G1080R

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164665
SMART Domains Protein: ENSMUSP00000132440
Gene: ENSMUSG00000024811

DomainStartEndE-ValueType
ANK 3 32 6.55e-5 SMART
ANK 36 65 1.24e-5 SMART
low complexity region 86 104 N/A INTRINSIC
ANK 123 152 1.69e-7 SMART
ANK 156 185 9.05e2 SMART
low complexity region 204 245 N/A INTRINSIC
SAM 252 318 1.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168654
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,731,964 M312L probably benign Het
Adam7 C A 14: 68,507,856 D640Y possibly damaging Het
Alcam T C 16: 52,274,236 Y384C probably damaging Het
Apob A G 12: 8,013,737 E289G probably damaging Het
Arhgap15 A T 2: 44,063,857 R198S probably benign Het
Bbs2 G T 8: 94,092,414 S109* probably null Het
Bfsp1 T C 2: 143,826,971 S569G probably benign Het
Chst9 A T 18: 15,453,239 I89N probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Csde1 T G 3: 103,039,934 D67E probably damaging Het
Csf2rb T G 15: 78,349,057 S855A possibly damaging Het
Cyp4a10 T A 4: 115,532,615 D472E probably damaging Het
Cyp4f18 C A 8: 72,009,096 R49L probably benign Het
Daam1 G T 12: 71,944,274 V221L unknown Het
Dbr1 T G 9: 99,583,891 D507E probably benign Het
Dhrs7c A G 11: 67,815,801 M188V probably benign Het
Dicer1 A T 12: 104,694,731 L1688* probably null Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
E2f3 G A 13: 29,918,636 T91I probably damaging Het
Etaa1 A T 11: 17,947,853 V157E probably damaging Het
Foxp2 A T 6: 15,394,771 T157S probably benign Het
Frem2 A G 3: 53,551,346 V2034A probably benign Het
Fzd10 T C 5: 128,602,116 V300A possibly damaging Het
Gbf1 A T 19: 46,268,454 M778L probably benign Het
Gm17472 T A 6: 42,981,134 N112K probably benign Het
Gria4 T C 9: 4,424,330 K845R probably benign Het
Hspa4l T A 3: 40,781,569 S541T probably benign Het
Igkv4-68 G A 6: 69,304,942 R82C probably damaging Het
Itgb1 A T 8: 128,720,010 I383F probably damaging Het
Kcnk12 T A 17: 87,746,605 K210* probably null Het
Limch1 C G 5: 66,993,173 D163E probably damaging Het
Mbd4 A T 6: 115,849,402 D188E probably damaging Het
Myh9 C T 15: 77,781,110 probably null Het
Nbeal2 T C 9: 110,644,666 E28G probably damaging Het
Nfatc4 A G 14: 55,826,659 E201G probably damaging Het
Nrap G A 19: 56,335,151 H1330Y probably damaging Het
Nudt14 A G 12: 112,935,028 S151P probably damaging Het
Olfr297 C A 7: 86,527,116 R120S probably damaging Het
Olfr58 T A 9: 19,783,218 F28L possibly damaging Het
Olfr706 T A 7: 106,886,596 T74S possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Paqr9 A G 9: 95,560,110 D51G probably damaging Het
Pcgf5 T A 19: 36,437,183 F80I probably damaging Het
Pkhd1 T G 1: 20,547,341 S1007R probably benign Het
Rab30 T C 7: 92,835,913 Y196H probably benign Het
Setd2 A T 9: 110,551,230 D1371V probably damaging Het
Slc48a1 A T 15: 97,790,700 I140F possibly damaging Het
Sorl1 A G 9: 42,033,583 V882A probably benign Het
Sptbn2 G T 19: 4,724,184 G88W probably damaging Het
Tdrd12 A G 7: 35,490,030 V427A possibly damaging Het
Tekt2 T C 4: 126,324,670 D69G probably benign Het
Tie1 C T 4: 118,480,510 V463I probably benign Het
Tmem150c G T 5: 100,079,954 H217N probably damaging Het
Ttll4 G A 1: 74,687,852 probably null Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36871633 missense probably benign 0.00
IGL01977:Tnks2 APN 19 36872590 critical splice donor site probably null
IGL02389:Tnks2 APN 19 36884103 missense probably benign 0.32
IGL02653:Tnks2 APN 19 36872451 missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36845743 missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36852821 missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36849358 missense possibly damaging 0.51
R0591:Tnks2 UTSW 19 36872562 missense probably damaging 0.99
R0648:Tnks2 UTSW 19 36862074 splice site probably null
R0894:Tnks2 UTSW 19 36890050 critical splice donor site probably null
R1397:Tnks2 UTSW 19 36880501 splice site probably benign
R1459:Tnks2 UTSW 19 36845531 splice site probably benign
R1674:Tnks2 UTSW 19 36871622 missense probably benign 0.03
R1742:Tnks2 UTSW 19 36876261 missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36845668 nonsense probably null
R2025:Tnks2 UTSW 19 36866066 missense probably damaging 0.99
R2898:Tnks2 UTSW 19 36872590 critical splice donor site probably null
R4422:Tnks2 UTSW 19 36845653 missense probably damaging 1.00
R4676:Tnks2 UTSW 19 36875271 nonsense probably null
R5357:Tnks2 UTSW 19 36849290 splice site silent
R5467:Tnks2 UTSW 19 36881776 missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36862346 missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36879352 missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36866204 intron probably benign
R7270:Tnks2 UTSW 19 36859145 missense
R7309:Tnks2 UTSW 19 36852536 missense probably damaging 1.00
R7310:Tnks2 UTSW 19 36879439 missense probably benign 0.12
R7516:Tnks2 UTSW 19 36871664 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTTCAAGCATTTAACATCCATGGG -3'
(R):5'- AATCATGCTGGCCCACTCAG -3'

Sequencing Primer
(F):5'- CTGATGTGCACAAAGCTCTG -3'
(R):5'- GGCCCACTCAGATCCTTTGG -3'
Posted On2016-07-06