Incidental Mutation 'R5243:4930447C04Rik'
List |< first << previous [record 67 of 9592] next >> last >|
ID401005
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene NameRIKEN cDNA 4930447C04 gene
SynonymsSix6as, Six6os1
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72881109-72940774 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 72909769 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489] [ENSMUST00000130635] [ENSMUST00000131033] [ENSMUST00000132067] [ENSMUST00000136075]
Predicted Effect probably null
Transcript: ENSMUST00000044000
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110489
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130635
Predicted Effect probably benign
Transcript: ENSMUST00000131033
AA Change: Y186N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119777
Gene: ENSMUSG00000021098
AA Change: Y186N

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132016
Predicted Effect probably benign
Transcript: ENSMUST00000132067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132901
Predicted Effect probably benign
Transcript: ENSMUST00000136075
Predicted Effect probably benign
Transcript: ENSMUST00000143960
SMART Domains Protein: ENSMUSP00000116391
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 1 70 6.1e-21 PFAM
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Cpne6 T A 14: 55,512,747 C112S probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1271:4930447C04Rik UTSW 12 72892883 missense possibly damaging 0.71
R1321:4930447C04Rik UTSW 12 72898544 splice site probably benign
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1424:4930447C04Rik UTSW 12 72892895 nonsense probably null
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R6312:4930447C04Rik UTSW 12 72889767 missense possibly damaging 0.86
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCACTTTAAAGCCAGATGACTATAC -3'
(R):5'- GGCATGTACTGAACAACTACAATTG -3'

Sequencing Primer
(F):5'- AACTGCTTGCTTCTGATCACATAGG -3'
(R):5'- ACTGAACAACTACAATTGAATGAAAC -3'
Posted On2016-07-06