Incidental Mutation 'R5243:Cpne6'
ID401010
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission 042814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R5243 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55512747 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 112 (C112S)
Ref Sequence ENSEMBL: ENSMUSP00000130799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074225] [ENSMUST00000076236] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074225
AA Change: C112S

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: C112S

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076236
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163767
AA Change: C112S

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: C112S

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165262
AA Change: C112S

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: C112S

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165725
AA Change: C112S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212
AA Change: C112S

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170155
Predicted Effect possibly damaging
Transcript: ENSMUST00000171643
AA Change: C112S

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: C112S

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,909,769 probably null Het
Aatk A G 11: 120,016,768 L78P probably damaging Het
Acadsb T A 7: 131,444,243 I412K probably damaging Het
Acer3 T C 7: 98,218,070 R246G possibly damaging Het
Atp1a3 T A 7: 24,994,569 I387F probably damaging Het
Atp6v1b2 A T 8: 69,103,739 M300L probably benign Het
Aurkb T A 11: 69,045,926 probably benign Het
Card10 C A 15: 78,780,672 G694V possibly damaging Het
Ccdc171 A G 4: 83,604,107 N336S probably damaging Het
Copg2 T C 6: 30,750,627 T720A probably benign Het
Coro2a A T 4: 46,545,620 W272R probably damaging Het
Ddx21 A G 10: 62,602,213 M1T probably null Het
Dohh A G 10: 81,387,369 R161G probably benign Het
Dsc1 A C 18: 20,099,159 V264G probably damaging Het
E4f1 A T 17: 24,447,318 C198S probably damaging Het
Evpl T A 11: 116,222,969 E1298D probably damaging Het
Grid2ip A T 5: 143,377,505 I246F probably damaging Het
H2-M1 A G 17: 36,671,301 F136S possibly damaging Het
Hck T C 2: 153,144,492 V387A probably damaging Het
Hdac1 G A 4: 129,516,853 probably benign Het
Hydin A C 8: 110,505,748 Q1633P possibly damaging Het
Igkv12-41 A G 6: 69,858,702 I22T probably damaging Het
Ints3 CA CAA 3: 90,401,144 probably null Het
Itpr2 C G 6: 146,187,546 W2188C probably damaging Het
Kcnt1 A G 2: 25,908,074 E899G probably damaging Het
Lgals8 C A 13: 12,454,764 V12L probably benign Het
Lgr6 T C 1: 135,109,272 probably benign Het
Lrrc8b T G 5: 105,480,946 I386S probably damaging Het
Mks1 T C 11: 87,856,678 probably benign Het
Mon1b A G 8: 113,637,921 D110G possibly damaging Het
Mpdz G T 4: 81,306,879 A1437E probably damaging Het
Nbeal1 T A 1: 60,270,328 N1753K probably damaging Het
Nceh1 T C 3: 27,241,688 V366A probably damaging Het
Ncor1 A T 11: 62,338,962 D893E probably damaging Het
Npc1 T A 18: 12,198,631 probably benign Het
Olfr1505 A G 19: 13,919,661 I214V probably damaging Het
Olfr344 T C 2: 36,568,643 L15P probably damaging Het
Podxl2 T C 6: 88,849,374 T317A probably benign Het
Prl8a9 T G 13: 27,562,463 Q54P probably damaging Het
Prpf31 C T 7: 3,638,754 R351* probably null Het
Pspc1 C T 14: 56,764,191 G242D probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rif1 T A 2: 52,111,824 H1763Q possibly damaging Het
Rpusd3 T C 6: 113,418,064 T85A probably benign Het
Rttn A G 18: 89,108,063 I1853M possibly damaging Het
Sacs T A 14: 61,205,957 C1817* probably null Het
Scrib A T 15: 76,065,252 V335E probably benign Het
Sdk2 A G 11: 113,825,086 L1549P possibly damaging Het
Slc25a11 C T 11: 70,646,098 G44S probably damaging Het
Slc6a3 A G 13: 73,571,451 Y533C possibly damaging Het
Slc7a5 A G 8: 121,896,535 V191A probably damaging Het
Son A G 16: 91,654,733 K123E probably damaging Het
Tcstv3 T A 13: 120,317,589 M8K probably benign Het
Tie1 A G 4: 118,482,351 V411A probably damaging Het
Upk3bl C A 5: 136,060,123 D1E possibly damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r75 T C 7: 86,164,239 N452D probably damaging Het
Wnk2 T A 13: 49,072,578 N1043I possibly damaging Het
Zfp407 A T 18: 84,561,091 H632Q probably damaging Het
Zfp423 T C 8: 87,773,647 K1174R probably benign Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1472:Cpne6 UTSW 14 55514635 missense probably benign 0.00
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4453:Cpne6 UTSW 14 55512597 missense probably damaging 1.00
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6475:Cpne6 UTSW 14 55513653 missense probably damaging 1.00
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R6787:Cpne6 UTSW 14 55515244 missense probably damaging 1.00
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCGCACAGGAAGTACCAG -3'
(R):5'- AGGTTGGCCCTTTGATCAGG -3'

Sequencing Primer
(F):5'- AGGGACAAGTGGCCTCAGTC -3'
(R):5'- GGTGGATTCAATTTCTACAGCAGCC -3'
Posted On2016-07-06