Incidental Mutation 'R5244:Cops4'
ID401042
Institutional Source Beutler Lab
Gene Symbol Cops4
Ensembl Gene ENSMUSG00000035297
Gene NameCOP9 signalosome subunit 4
SynonymsD5Ertd774e, COP9 complex S4
MMRRC Submission 042815-MU
Accession Numbers

Genbank: NM_012001; MGI: 1349414

Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5244 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100518309-100547803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100533375 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 131 (Q131K)
Ref Sequence ENSEMBL: ENSMUSP00000121979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045993] [ENSMUST00000123069] [ENSMUST00000123492] [ENSMUST00000146476] [ENSMUST00000151414]
Predicted Effect probably benign
Transcript: ENSMUST00000045993
AA Change: Q182K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048416
Gene: ENSMUSG00000035297
AA Change: Q182K

DomainStartEndE-ValueType
PINT 295 377 2.09e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123069
Predicted Effect probably benign
Transcript: ENSMUST00000123492
AA Change: Q97K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119737
Gene: ENSMUSG00000035297
AA Change: Q97K

DomainStartEndE-ValueType
Pfam:PCI 179 251 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123559
Predicted Effect probably benign
Transcript: ENSMUST00000146476
AA Change: Q131K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147729
Predicted Effect probably benign
Transcript: ENSMUST00000151414
AA Change: Q131K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gm5117 A G 8: 31,738,277 noncoding transcript Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Naip5 C T 13: 100,245,662 V180I probably benign Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr1285 T A 2: 111,408,554 noncoding transcript Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Pirb G A 7: 3,716,063 A609V probably benign Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ttll4 T C 1: 74,696,448 V1005A probably benign Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Cops4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Cops4 APN 5 100533555 missense probably damaging 1.00
IGL02152:Cops4 APN 5 100533590 missense probably benign 0.20
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0326:Cops4 UTSW 5 100528542 missense probably damaging 0.99
R0494:Cops4 UTSW 5 100528662 missense probably damaging 0.97
R0639:Cops4 UTSW 5 100537460 missense possibly damaging 0.48
R1162:Cops4 UTSW 5 100530157 splice site probably benign
R1400:Cops4 UTSW 5 100533546 missense probably damaging 1.00
R4209:Cops4 UTSW 5 100547486 unclassified probably benign
R4943:Cops4 UTSW 5 100547426 missense probably benign 0.00
R5350:Cops4 UTSW 5 100518539 missense possibly damaging 0.81
R5855:Cops4 UTSW 5 100547414 missense probably benign
R6010:Cops4 UTSW 5 100543910 missense possibly damaging 0.63
R6026:Cops4 UTSW 5 100542328 unclassified probably benign
R7390:Cops4 UTSW 5 100543875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACTATAGTGTCCGGTAAGC -3'
(R):5'- TGGGCGGCCTCAATGAATTTC -3'

Sequencing Primer
(F):5'- AGCCTGAAACTTGGCACTTG -3'
(R):5'- TCCTTCTGTAATCAAGGACACGCG -3'
Posted On2016-07-06