Incidental Mutation 'R5245:Olfml2b'
ID401087
Institutional Source Beutler Lab
Gene Symbol Olfml2b
Ensembl Gene ENSMUSG00000038463
Gene Nameolfactomedin-like 2B
Synonymsphotomedin-2, 1110018N05Rik, 4832415H08Rik
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5245 (G1)
Quality Score196
Status Validated
Chromosome1
Chromosomal Location170644532-170682789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170668874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 358 (V358A)
Ref Sequence ENSEMBL: ENSMUSP00000047291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046792]
Predicted Effect probably benign
Transcript: ENSMUST00000046792
AA Change: V358A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047291
Gene: ENSMUSG00000038463
AA Change: V358A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 41 68 N/A INTRINSIC
coiled coil region 179 213 N/A INTRINSIC
low complexity region 233 238 N/A INTRINSIC
Blast:OLF 254 306 1e-6 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 343 382 N/A INTRINSIC
OLF 492 746 4.76e-61 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an olfactomedin domain-containing protein. Most olfactomedin domain-containing proteins are secreted glycoproteins. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Olfml2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Olfml2b APN 1 170669066 missense probably damaging 0.96
IGL01871:Olfml2b APN 1 170662355 splice site probably benign
IGL02475:Olfml2b APN 1 170682174 missense probably damaging 1.00
IGL02657:Olfml2b APN 1 170681076 missense probably benign 0.00
IGL03375:Olfml2b APN 1 170649832 missense probably benign 0.35
PIT4280001:Olfml2b UTSW 1 170647736 missense probably damaging 1.00
R0040:Olfml2b UTSW 1 170668751 missense probably benign 0.00
R0194:Olfml2b UTSW 1 170681115 missense possibly damaging 0.89
R0834:Olfml2b UTSW 1 170647844 missense probably benign 0.00
R1218:Olfml2b UTSW 1 170649782 missense probably damaging 1.00
R1386:Olfml2b UTSW 1 170681162 missense probably damaging 0.97
R1420:Olfml2b UTSW 1 170669027 missense probably benign 0.01
R1699:Olfml2b UTSW 1 170645073 missense possibly damaging 0.89
R1730:Olfml2b UTSW 1 170681789 missense probably damaging 1.00
R1755:Olfml2b UTSW 1 170681777 missense probably damaging 1.00
R1869:Olfml2b UTSW 1 170669243 missense probably damaging 0.96
R2295:Olfml2b UTSW 1 170662538 splice site probably benign
R2394:Olfml2b UTSW 1 170649750 missense possibly damaging 0.82
R3784:Olfml2b UTSW 1 170681982 missense probably damaging 0.96
R4523:Olfml2b UTSW 1 170669222 missense probably benign
R4611:Olfml2b UTSW 1 170644947 missense probably damaging 0.99
R4900:Olfml2b UTSW 1 170662378 missense probably damaging 1.00
R5201:Olfml2b UTSW 1 170668864 missense probably benign
R5268:Olfml2b UTSW 1 170649761 missense probably damaging 1.00
R5283:Olfml2b UTSW 1 170681189 nonsense probably null
R5348:Olfml2b UTSW 1 170662426 missense probably benign 0.02
R5408:Olfml2b UTSW 1 170644976 missense probably damaging 1.00
R5673:Olfml2b UTSW 1 170682129 missense probably damaging 1.00
R5758:Olfml2b UTSW 1 170669264 critical splice donor site probably null
R5893:Olfml2b UTSW 1 170662473 missense probably benign
R6290:Olfml2b UTSW 1 170649790 nonsense probably null
R6380:Olfml2b UTSW 1 170669231 missense probably benign 0.00
R6778:Olfml2b UTSW 1 170645070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGTGTTCCTTGTCCTGTGC -3'
(R):5'- ATTGCTGGAAGTGGCTGGAC -3'

Sequencing Primer
(F):5'- TGTGCCACAAATGAGCCTTG -3'
(R):5'- TGAGACTTGGGTAGAAGGCATCAC -3'
Posted On2016-07-06