Incidental Mutation 'R5245:Srsf11'
ID401097
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Nameserine/arginine-rich splicing factor 11
Synonyms0610009J05Rik, Sfrs11, 2610019N13Rik
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158010473-158036639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 158023344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
Predicted Effect probably benign
Transcript: ENSMUST00000069025
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072875
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect probably benign
Transcript: ENSMUST00000121326
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133090
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140491
SMART Domains Protein: ENSMUSP00000118767
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
Blast:RRM 2 42 1e-21 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115487
Gene: ENSMUSG00000055436
AA Change: R90Q

DomainStartEndE-ValueType
RRM 7 81 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196034
Predicted Effect probably benign
Transcript: ENSMUST00000198705
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 158012035 unclassified probably benign
IGL01600:Srsf11 APN 3 158019442 splice site probably benign
IGL02724:Srsf11 APN 3 158016431 unclassified probably benign
IGL03147:Srsf11 UTSW 3 158026740 missense probably damaging 1.00
R0195:Srsf11 UTSW 3 158036535 unclassified probably benign
R0578:Srsf11 UTSW 3 158012067 unclassified probably benign
R0580:Srsf11 UTSW 3 158012067 unclassified probably benign
R1075:Srsf11 UTSW 3 158012790 intron probably benign
R1604:Srsf11 UTSW 3 158019311 critical splice donor site probably null
R1797:Srsf11 UTSW 3 158019428 missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 158016427 unclassified probably benign
R1899:Srsf11 UTSW 3 158031580 unclassified probably benign
R2105:Srsf11 UTSW 3 158019345 missense probably damaging 0.99
R4605:Srsf11 UTSW 3 158022923 nonsense probably null
R4655:Srsf11 UTSW 3 158023335 missense probably benign 0.15
R4737:Srsf11 UTSW 3 158026732 nonsense probably null
R5244:Srsf11 UTSW 3 158023344 unclassified probably benign
R5379:Srsf11 UTSW 3 158023344 unclassified probably benign
R5401:Srsf11 UTSW 3 158023344 unclassified probably benign
R5625:Srsf11 UTSW 3 158023344 unclassified probably benign
R5763:Srsf11 UTSW 3 158023344 unclassified probably benign
R5814:Srsf11 UTSW 3 158023344 unclassified probably benign
R5938:Srsf11 UTSW 3 158023344 unclassified probably benign
R5944:Srsf11 UTSW 3 158023344 unclassified probably benign
R5945:Srsf11 UTSW 3 158023344 unclassified probably benign
R6126:Srsf11 UTSW 3 158023344 unclassified probably benign
R6175:Srsf11 UTSW 3 158023344 unclassified probably benign
R6427:Srsf11 UTSW 3 158023344 unclassified probably benign
R6435:Srsf11 UTSW 3 158023344 unclassified probably benign
R6436:Srsf11 UTSW 3 158023344 unclassified probably benign
R6614:Srsf11 UTSW 3 158023344 unclassified probably benign
R6616:Srsf11 UTSW 3 158023344 unclassified probably benign
X0017:Srsf11 UTSW 3 158016349 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGATACACCACCTGAGTTTG -3'
(R):5'- AGCCCTACTCTTGATTCCAACAG -3'

Sequencing Primer
(F):5'- CACCACCTGAGTTTGTTGAAAG -3'
(R):5'- ACTCTTGATTCCAACAGAATATTTCC -3'
Posted On2016-07-06