Incidental Mutation 'R5245:Shtn1'
ID401135
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59032220 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 190 (N190I)
Ref Sequence ENSEMBL: ENSMUSP00000126227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000163821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047511
AA Change: N190I

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: N190I

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163821
AA Change: N190I

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362
AA Change: N190I

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1212:Shtn1 UTSW 19 59050890 missense probably damaging 1.00
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3552:Shtn1 UTSW 19 58975038 missense probably benign 0.28
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTCAGTGGTGAAATAATAGACATG -3'
(R):5'- CCCAGGTTACCTCAGAGTTTC -3'

Sequencing Primer
(F):5'- TAGACATGAGATAAAGTCACTGCTG -3'
(R):5'- GTTTCACAGAAGAGCTTTCAGGC -3'
Posted On2016-07-06