Incidental Mutation 'R5247:Lpcat4'
ID401177
Institutional Source Beutler Lab
Gene Symbol Lpcat4
Ensembl Gene ENSMUSG00000027134
Gene Namelysophosphatidylcholine acyltransferase 4
SynonymsAytl3, LPEAT2, Agpat7
MMRRC Submission 042818-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5247 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112239468-112247111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112242515 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 173 (H173R)
Ref Sequence ENSEMBL: ENSMUSP00000028554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028554
AA Change: H173R

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028554
Gene: ENSMUSG00000027134
AA Change: H173R

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 92 113 N/A INTRINSIC
PlsC 123 234 5.73e-24 SMART
low complexity region 411 422 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136219
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 1-acylglycerol-3-phosphate O-acyltransferase (EC 2.3.1.51) family, such as AGPAT7, catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA), a precursor in the biosynthesis of all glycerolipids. Both LPA and PA are involved in signal transduction (Ye et al., 2005 [PubMed 16243729]).[supplied by OMIM, May 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atad2 A T 15: 58,104,478 L585* probably null Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Cacng1 T C 11: 107,716,279 H38R probably benign Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Gm8251 A C 1: 44,057,006 L1644* probably null Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Isg20l2 A G 3: 87,931,613 N44D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Slc16a7 A T 10: 125,231,314 M152K probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Lpcat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Lpcat4 APN 2 112243043 unclassified probably null
IGL02319:Lpcat4 APN 2 112243884 missense probably damaging 1.00
IGL02950:Lpcat4 APN 2 112244042 missense possibly damaging 0.95
R0131:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0131:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0132:Lpcat4 UTSW 2 112246748 missense probably damaging 0.99
R0271:Lpcat4 UTSW 2 112243245 splice site probably null
R0884:Lpcat4 UTSW 2 112242732 missense probably damaging 1.00
R1387:Lpcat4 UTSW 2 112244676 missense probably benign
R1731:Lpcat4 UTSW 2 112243843 missense probably damaging 1.00
R1988:Lpcat4 UTSW 2 112242542 missense possibly damaging 0.80
R2047:Lpcat4 UTSW 2 112244797 critical splice donor site probably null
R3924:Lpcat4 UTSW 2 112246716 missense possibly damaging 0.54
R4001:Lpcat4 UTSW 2 112239951 missense probably benign 0.21
R4326:Lpcat4 UTSW 2 112246392 missense probably benign 0.00
R5959:Lpcat4 UTSW 2 112240035 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGCCTCCATACATAGATTGTAGC -3'
(R):5'- CCTTCTTGTTGGAACAGGTGC -3'

Sequencing Primer
(F):5'- GATTGTAGCAATAAATGGATGGTTG -3'
(R):5'- TGGAACAGGTGCCTTCAGG -3'
Posted On2016-07-06