Incidental Mutation 'R5247:Isg20l2'
ID401180
Institutional Source Beutler Lab
Gene Symbol Isg20l2
Ensembl Gene ENSMUSG00000048039
Gene Nameinterferon stimulated exonuclease gene 20-like 2
Synonyms
MMRRC Submission 042818-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R5247 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87930314-87940686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87931613 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 44 (N44D)
Ref Sequence ENSEMBL: ENSMUSP00000059783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000055984] [ENSMUST00000160074] [ENSMUST00000160143] [ENSMUST00000160648] [ENSMUST00000164439]
Predicted Effect probably benign
Transcript: ENSMUST00000005016
SMART Domains Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 293 1.5e-29 PFAM
low complexity region 385 402 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055984
AA Change: N44D

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039
AA Change: N44D

DomainStartEndE-ValueType
low complexity region 128 145 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
EXOIII 193 359 3.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159967
Predicted Effect probably benign
Transcript: ENSMUST00000160074
SMART Domains Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 69 229 1.3e-29 PFAM
low complexity region 321 338 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160143
SMART Domains Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 247 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161471
Predicted Effect probably benign
Transcript: ENSMUST00000164439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168070
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that may be involved in the processing of the 12S pre-rRNA. Pseudogenes have been identified on chromosomes 6 and 11. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atad2 A T 15: 58,104,478 L585* probably null Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Cacng1 T C 11: 107,716,279 H38R probably benign Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Gm8251 A C 1: 44,057,006 L1644* probably null Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Lpcat4 A G 2: 112,242,515 H173R possibly damaging Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Slc16a7 A T 10: 125,231,314 M152K probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Isg20l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Isg20l2 APN 3 87931761 missense probably damaging 0.99
IGL02331:Isg20l2 APN 3 87932087 missense probably damaging 0.99
FR4304:Isg20l2 UTSW 3 87931712 unclassified probably benign
FR4340:Isg20l2 UTSW 3 87931712 nonsense probably null
FR4449:Isg20l2 UTSW 3 87931713 unclassified probably benign
FR4589:Isg20l2 UTSW 3 87931717 unclassified probably benign
FR4976:Isg20l2 UTSW 3 87931715 nonsense probably null
R0331:Isg20l2 UTSW 3 87931785 missense probably damaging 1.00
R0465:Isg20l2 UTSW 3 87931680 missense probably benign 0.01
R1398:Isg20l2 UTSW 3 87938754 missense probably benign 0.34
R1679:Isg20l2 UTSW 3 87932085 missense probably damaging 1.00
R3040:Isg20l2 UTSW 3 87931995 missense probably benign
R4910:Isg20l2 UTSW 3 87939263 missense probably damaging 1.00
R5015:Isg20l2 UTSW 3 87931981 missense possibly damaging 0.52
R5591:Isg20l2 UTSW 3 87930424 unclassified probably benign
R6261:Isg20l2 UTSW 3 87932088 missense probably damaging 1.00
R6755:Isg20l2 UTSW 3 87931689 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCTCCACATGTTGAACTATGGG -3'
(R):5'- AGCCAAGACAATGGTGCTTTC -3'

Sequencing Primer
(F):5'- CCACATGTTGAACTATGGGATTCC -3'
(R):5'- CAAGACAATGGTGCTTTCTTGTC -3'
Posted On2016-07-06