Incidental Mutation 'R5258:Cfap69'
ID401228
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 5604271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000061008] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000135252] [ENSMUST00000148347] [ENSMUST00000148347] [ENSMUST00000196165]
Predicted Effect probably null
Transcript: ENSMUST00000054865
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061008
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061008
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132510
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135252
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135252
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148347
SMART Domains Protein: ENSMUSP00000119944
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148347
SMART Domains Protein: ENSMUSP00000119944
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196165
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199314
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
R7455:Cfap69 UTSW 5 5625873 missense possibly damaging 0.92
R7544:Cfap69 UTSW 5 5595936 missense not run
R7547:Cfap69 UTSW 5 5604290 missense possibly damaging 0.88
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGACAAGTTTCTCCTTCCG -3'
(R):5'- AGTCATGGCACCTGGTAGAG -3'

Sequencing Primer
(F):5'- GAAGACAAGTTTCTCCTTCCGTTATG -3'
(R):5'- GTGGGCTAGAATGTGAAAACTCTTCC -3'
Posted On2016-07-06