Incidental Mutation 'R5259:Olfr319'
ID401313
Institutional Source Beutler Lab
Gene Symbol Olfr319
Ensembl Gene ENSMUSG00000064044
Gene Nameolfactory receptor 319
SynonymsMOR285-2, GA_x6K02T2NKPP-708319-707399
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58699162-58703472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58701952 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 84 (N84D)
Ref Sequence ENSEMBL: ENSMUSP00000150883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076965] [ENSMUST00000215962]
Predicted Effect probably benign
Transcript: ENSMUST00000076965
AA Change: N84D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076232
Gene: ENSMUSG00000064044
AA Change: N84D

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.8e-46 PFAM
Pfam:7tm_1 41 290 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215238
Predicted Effect probably benign
Transcript: ENSMUST00000215962
AA Change: N84D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Olfr319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Olfr319 APN 11 58701767 missense probably benign
IGL01955:Olfr319 APN 11 58702129 missense probably damaging 0.97
IGL02145:Olfr319 APN 11 58702060 missense probably damaging 0.99
IGL02283:Olfr319 APN 11 58702276 missense probably damaging 0.96
R0468:Olfr319 UTSW 11 58701793 missense probably damaging 1.00
R0499:Olfr319 UTSW 11 58702243 missense probably benign 0.01
R0815:Olfr319 UTSW 11 58702609 missense possibly damaging 0.84
R0885:Olfr319 UTSW 11 58702087 missense possibly damaging 0.93
R1081:Olfr319 UTSW 11 58702498 missense probably damaging 1.00
R1603:Olfr319 UTSW 11 58702460 missense probably benign 0.00
R1935:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1936:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1938:Olfr319 UTSW 11 58702623 makesense probably null
R2436:Olfr319 UTSW 11 58702126 missense probably damaging 0.97
R4243:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4244:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4742:Olfr319 UTSW 11 58701859 missense probably benign
R4801:Olfr319 UTSW 11 58701791 missense probably benign
R4802:Olfr319 UTSW 11 58701791 missense probably benign
R4927:Olfr319 UTSW 11 58701807 missense probably damaging 1.00
R5259:Olfr319 UTSW 11 58701953 missense possibly damaging 0.83
R5393:Olfr319 UTSW 11 58702500 missense probably damaging 0.97
R5471:Olfr319 UTSW 11 58702325 missense probably damaging 0.98
R5571:Olfr319 UTSW 11 58702051 missense probably damaging 1.00
R6746:Olfr319 UTSW 11 58702543 missense probably benign
R7045:Olfr319 UTSW 11 58701669 start gained probably benign
X0065:Olfr319 UTSW 11 58702489 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGACTTCACCTTGGTTGGTC -3'
(R):5'- CATGGAGCAGCAGATCTTCCTG -3'

Sequencing Primer
(F):5'- GTATGGACACATGGACACCTTC -3'
(R):5'- TCATGAGCACAGGGTAGT -3'
Posted On2016-07-06