Incidental Mutation 'R5260:Efcab5'
ID401392
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene NameEF-hand calcium binding domain 5
Synonyms4930563A03Rik
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77089915-77188968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77137651 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 421 (S421T)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108400
AA Change: S421T

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: S421T

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130901
AA Change: S285T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: S285T

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148985
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGACTTTCTGCGTTGTCC -3'
(R):5'- GTCCCGAAGAAGCTCTACAG -3'

Sequencing Primer
(F):5'- GCCCAGGTTCTGAAATTGACC -3'
(R):5'- GCTCTACAGTAGAACAAACTCGG -3'
Posted On2016-07-06