Incidental Mutation 'R5260:Kif5b'
ID401411
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Namekinesin family member 5B
Synonymskinesin heavy chain, Khc
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6201002-6242174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6211058 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 802 (L802P)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
Predicted Effect probably damaging
Transcript: ENSMUST00000025083
AA Change: L802P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: L802P

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168187
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGGATCAGAGGACCCACGTTC -3'
(R):5'- TTGAAAGGTACTGCATGGGC -3'

Sequencing Primer
(F):5'- GAGGACCCACGTTCCTCCAC -3'
(R):5'- CAATTTAGGGTTATGCAAGACAGAC -3'
Posted On2016-07-06