Incidental Mutation 'R5261:Gtf2ird2'
ID401429
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134216219 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 440 (I440V)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354] [ENSMUST00000152587]
Predicted Effect probably benign
Transcript: ENSMUST00000016086
AA Change: I440V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: I440V

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000016094
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111275
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128842
Predicted Effect probably benign
Transcript: ENSMUST00000135588
Predicted Effect probably benign
Transcript: ENSMUST00000144086
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146354
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152587
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Amfr T A 8: 93,976,170 probably null Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
D630045J12Rik A T 6: 38,194,620 L871Q probably benign Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Olfr995 A G 2: 85,438,897 V87A probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pcdh10 G A 3: 45,381,812 G854R probably damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 unclassified probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGACAACCGGAGCTATGTA -3'
(R):5'- TAAGCTCCCGGCCACCTC -3'

Sequencing Primer
(F):5'- CGGAGCTATGTAGAAATACCCTGTC -3'
(R):5'- AATGGTTGCTCTGGACACAC -3'
Posted On2016-07-06