Incidental Mutation 'R5261:Amfr'
ID401442
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Nameautocrine motility factor receptor
Synonymsgp78
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93971588-94012842 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 93976170 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053766]
Predicted Effect probably null
Transcript: ENSMUST00000053766
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139702
Meta Mutation Damage Score 0.55 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
D630045J12Rik A T 6: 38,194,620 L871Q probably benign Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gtf2ird2 A G 5: 134,216,219 I440V probably benign Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Olfr995 A G 2: 85,438,897 V87A probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pcdh10 G A 3: 45,381,812 G854R probably damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 93987508 critical splice acceptor site probably null
IGL02169:Amfr APN 8 94005230 splice site probably null
IGL03218:Amfr APN 8 94000336 missense probably damaging 0.97
FR4449:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4737:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4976:Amfr UTSW 8 94012292 unclassified probably benign
R0344:Amfr UTSW 8 93987370 splice site probably null
R0532:Amfr UTSW 8 93999108 missense probably damaging 1.00
R1056:Amfr UTSW 8 93985469 missense probably benign 0.27
R1295:Amfr UTSW 8 93974804 missense probably benign 0.26
R1386:Amfr UTSW 8 93985399 missense possibly damaging 0.58
R1450:Amfr UTSW 8 93987747 missense probably benign 0.45
R1613:Amfr UTSW 8 93999226 missense probably benign 0.00
R1703:Amfr UTSW 8 93974243 missense probably benign
R2857:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2858:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2859:Amfr UTSW 8 94005214 missense probably damaging 1.00
R3109:Amfr UTSW 8 94000306 missense probably damaging 1.00
R3708:Amfr UTSW 8 93983320 missense probably benign 0.05
R4456:Amfr UTSW 8 93984940 missense possibly damaging 0.80
R4600:Amfr UTSW 8 93974221 missense probably damaging 0.99
R4952:Amfr UTSW 8 93973159 unclassified probably benign
R5391:Amfr UTSW 8 93976048 missense probably damaging 1.00
R5788:Amfr UTSW 8 94000314 missense probably damaging 1.00
R6238:Amfr UTSW 8 94000364 missense probably damaging 1.00
R6584:Amfr UTSW 8 93974155 missense probably benign 0.00
R6795:Amfr UTSW 8 94000333 missense probably benign 0.09
R6955:Amfr UTSW 8 94000376 missense probably damaging 1.00
R6978:Amfr UTSW 8 94000387 missense probably damaging 0.99
R7097:Amfr UTSW 8 94012009 missense probably benign 0.00
R7224:Amfr UTSW 8 93984856 missense probably damaging 1.00
R7260:Amfr UTSW 8 93976148 missense possibly damaging 0.80
R7289:Amfr UTSW 8 93999126 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TAGATGCCAGCCTCTGACAG -3'
(R):5'- TCCCAGAAGTCTAGTACCCTAC -3'

Sequencing Primer
(F):5'- CTCTGACAGGAGCCAATGG -3'
(R):5'- CAACAATAAAAAGAAAGCAGTGTGC -3'
Posted On2016-07-06