Incidental Mutation 'R5261:Vps51'
ID401471
Institutional Source Beutler Lab
Gene Symbol Vps51
Ensembl Gene ENSMUSG00000024797
Gene NameVPS51 GARP complex subunit
Synonyms
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6067842-6080324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6071033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 283 (E283D)
Ref Sequence ENSEMBL: ENSMUSP00000123994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000160233] [ENSMUST00000160590] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162810]
Predicted Effect probably benign
Transcript: ENSMUST00000025711
AA Change: E283D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799
AA Change: E283D

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025713
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159211
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
AA Change: E283D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797
AA Change: E283D

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159869
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160519
Predicted Effect probably benign
Transcript: ENSMUST00000160590
SMART Domains Protein: ENSMUSP00000123857
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Vps51 63 121 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161222
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated protein 51 family. The encoded protein is a component of the Golgi-associated retrograde protein complex which acts as a tethering factor for carriers in retrograde transport from the early and late endosomes to the trans-Golgi network. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Amfr T A 8: 93,976,170 probably null Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
D630045J12Rik A T 6: 38,194,620 L871Q probably benign Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gtf2ird2 A G 5: 134,216,219 I440V probably benign Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Olfr995 A G 2: 85,438,897 V87A probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pcdh10 G A 3: 45,381,812 G854R probably damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in Vps51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03095:Vps51 APN 19 6070048 missense probably damaging 1.00
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0239:Vps51 UTSW 19 6071437 nonsense probably null
R0239:Vps51 UTSW 19 6071437 nonsense probably null
R1533:Vps51 UTSW 19 6071467 missense probably benign 0.04
R1909:Vps51 UTSW 19 6069469 missense probably benign 0.03
R2022:Vps51 UTSW 19 6071582 missense probably benign 0.02
R2146:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2148:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2149:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2901:Vps51 UTSW 19 6076438 missense probably damaging 0.99
R3717:Vps51 UTSW 19 6077168 utr 3 prime probably benign
R3769:Vps51 UTSW 19 6076348 missense possibly damaging 0.54
R5192:Vps51 UTSW 19 6070467 missense possibly damaging 0.88
R5210:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5256:Vps51 UTSW 19 6070488 missense probably benign 0.00
R5260:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5274:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5294:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5295:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5389:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5391:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5392:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5393:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5421:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5422:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5497:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5498:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5499:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5671:Vps51 UTSW 19 6068194 missense probably benign 0.18
R5963:Vps51 UTSW 19 6068290 missense probably damaging 1.00
R5989:Vps51 UTSW 19 6076372 missense probably damaging 0.96
R6427:Vps51 UTSW 19 6070917 missense possibly damaging 0.77
R7247:Vps51 UTSW 19 6077389 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CAACCAGTGCAAAGTAGCGG -3'
(R):5'- GCCTGGTCATTGTTCTCCAAAC -3'

Sequencing Primer
(F):5'- CCAGCTCCTGCGCAAAG -3'
(R):5'- TCCAAACACATCGAGTGC -3'
Posted On2016-07-06