Incidental Mutation 'R5262:Wwp1'
ID401487
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19631057 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 659 (F659L)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035982
AA Change: F659L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: F659L

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108246
AA Change: F659L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: F659L

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGCTTGTAACTAAGGGAGGATATAG -3'
(R):5'- TGCAGAGTTAGCAGGACTGG -3'

Sequencing Primer
(F):5'- TGTCCATGCAGATCCAAGG -3'
(R):5'- CCTGCATGTATGTGTATGTGCATGC -3'
Posted On2016-07-06