Incidental Mutation 'R0414:Olfr1217'
ID40150
Institutional Source Beutler Lab
Gene Symbol Olfr1217
Ensembl Gene ENSMUSG00000101391
Gene Nameolfactory receptor 1217
SynonymsMOR233-4, GA_x6K02T2Q125-50504545-50503631
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89021336-89032065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89023146 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 286 (Y286H)
Ref Sequence ENSEMBL: ENSMUSP00000149931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099799] [ENSMUST00000213669] [ENSMUST00000214022] [ENSMUST00000216000] [ENSMUST00000216592] [ENSMUST00000217000]
Predicted Effect probably damaging
Transcript: ENSMUST00000099799
AA Change: Y286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097387
Gene: ENSMUSG00000101391
AA Change: Y286H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-48 PFAM
Pfam:7tm_1 39 286 6.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213669
AA Change: Y286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214022
AA Change: Y286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216000
Predicted Effect probably damaging
Transcript: ENSMUST00000216592
AA Change: Y286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Olfr1217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr1217 APN 2 89023175 missense probably benign 0.00
IGL02034:Olfr1217 APN 2 89023671 missense probably benign 0.07
IGL03328:Olfr1217 APN 2 89023855 nonsense probably null
R0153:Olfr1217 UTSW 2 89023196 missense probably benign 0.00
R0544:Olfr1217 UTSW 2 89023826 missense probably damaging 1.00
R1994:Olfr1217 UTSW 2 89023143 missense probably damaging 1.00
R2217:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3738:Olfr1217 UTSW 2 89023610 missense probably damaging 1.00
R3794:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3808:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3809:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R5252:Olfr1217 UTSW 2 89023254 missense probably damaging 0.98
R5448:Olfr1217 UTSW 2 89023501 missense probably benign
R7524:Olfr1217 UTSW 2 89023971 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTCCTCTCCACTGAACTGGATAC -3'
(R):5'- GACGTAAAGCTCTCTCCACCTGTG -3'

Sequencing Primer
(F):5'- gtcctcttctccatctgtctc -3'
(R):5'- CTGTGGGTCCCATATAACTGTTG -3'
Posted On2013-05-23