Incidental Mutation 'R5262:Zbtb24'
ID401510
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Namezinc finger and BTB domain containing 24
SynonymsZNF450
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5262 (G1)
Quality Score222
Status Validated
Chromosome10
Chromosomal Location41450383-41465574 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 41464560 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 529 (Q529*)
Ref Sequence ENSEMBL: ENSMUSP00000148861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]
Predicted Effect probably null
Transcript: ENSMUST00000080771
AA Change: Q551*
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: Q551*

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213797
AA Change: Q529*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Meta Mutation Damage Score 0.612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41451997 missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41464581 missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41456618 splice site probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAGTGTGGCTTACAGTTC -3'
(R):5'- CATCTGGCCTCCAATCACACTG -3'

Sequencing Primer
(F):5'- GTTCGCTCGCCTAGACAATTTGAAG -3'
(R):5'- TCACACTGAGGCTCTGAATG -3'
Posted On2016-07-06