Incidental Mutation 'R5262:Lilrb4a'
ID401511
Institutional Source Beutler Lab
Gene Symbol Lilrb4a
Ensembl Gene ENSMUSG00000112148
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4A
SynonymsLilrb4, CD85K, ILT3, HM18, Gp49b
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51490956-51496611 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51493207 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078778] [ENSMUST00000078778] [ENSMUST00000078778] [ENSMUST00000078778] [ENSMUST00000217705] [ENSMUST00000217705] [ENSMUST00000217706] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218617] [ENSMUST00000219696] [ENSMUST00000219696] [ENSMUST00000220182] [ENSMUST00000220182] [ENSMUST00000220226] [ENSMUST00000220226]
Predicted Effect probably null
Transcript: ENSMUST00000078778
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078778
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078778
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078778
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105481
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105481
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105482
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105482
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217705
Predicted Effect probably null
Transcript: ENSMUST00000217705
Predicted Effect probably null
Transcript: ENSMUST00000217706
Predicted Effect probably null
Transcript: ENSMUST00000217706
Predicted Effect probably benign
Transcript: ENSMUST00000218123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect probably benign
Transcript: ENSMUST00000218617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219388
Predicted Effect probably null
Transcript: ENSMUST00000219696
Predicted Effect probably null
Transcript: ENSMUST00000219696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220166
Predicted Effect probably null
Transcript: ENSMUST00000220182
Predicted Effect probably null
Transcript: ENSMUST00000220182
Predicted Effect probably null
Transcript: ENSMUST00000220226
Predicted Effect probably null
Transcript: ENSMUST00000220226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220402
Meta Mutation Damage Score 0.522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased sensitivity to IgE-dependent passive cutaneous anaphylaxis and a reduced threshold for antigen challenge in active cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Lilrb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Lilrb4a APN 10 51494065 missense probably benign 0.42
IGL02057:Lilrb4a APN 10 51492007 missense possibly damaging 0.81
IGL02386:Lilrb4a APN 10 51491226 nonsense probably null
IGL02999:Lilrb4a APN 10 51494143 missense probably damaging 1.00
IGL03292:Lilrb4a APN 10 51494846 unclassified probably null
IGL03382:Lilrb4a APN 10 51491520 missense probably benign 0.10
R0276:Lilrb4a UTSW 10 51491581 missense probably benign 0.01
R0470:Lilrb4a UTSW 10 51494827 missense possibly damaging 0.87
R1459:Lilrb4a UTSW 10 51491587 missense probably benign 0.44
R1675:Lilrb4a UTSW 10 51496185 missense probably benign 0.37
R1819:Lilrb4a UTSW 10 51496028 missense probably damaging 1.00
R1914:Lilrb4a UTSW 10 51491949 missense probably benign 0.04
R2265:Lilrb4a UTSW 10 51491537 nonsense probably null
R2338:Lilrb4a UTSW 10 51491700 missense probably benign 0.13
R2884:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R2886:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R4322:Lilrb4a UTSW 10 51491611 missense probably damaging 1.00
R4624:Lilrb4a UTSW 10 51491488 missense probably damaging 1.00
R4923:Lilrb4a UTSW 10 51492043 missense possibly damaging 0.67
R5001:Lilrb4a UTSW 10 51491420 splice site probably null
R6224:Lilrb4a UTSW 10 51491649 missense probably damaging 1.00
R7447:Lilrb4a UTSW 10 51491053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTCACAAAACCTTGTCTGC -3'
(R):5'- TGTTCAGGGAGATGGAGCCTAG -3'

Sequencing Primer
(F):5'- GTCTGCAACAGGGTCATATCC -3'
(R):5'- GCCATCAGAACATCTTGTAAAGG -3'
Posted On2016-07-06